ID: 998285624

View in Genome Browser
Species Human (GRCh38)
Location 5:140857732-140857754
Sequence GCGGGAGACGCCAGCAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998285624_998285632 9 Left 998285624 5:140857732-140857754 CCCGCGCTGCTGGCGTCTCCCGC 0: 1
1: 0
2: 2
3: 30
4: 173
Right 998285632 5:140857764-140857786 GGGCGGTGCAGTCAGTGAGCTGG 0: 1
1: 0
2: 2
3: 16
4: 203
998285624_998285633 17 Left 998285624 5:140857732-140857754 CCCGCGCTGCTGGCGTCTCCCGC 0: 1
1: 0
2: 2
3: 30
4: 173
Right 998285633 5:140857772-140857794 CAGTCAGTGAGCTGGTGCTGCGG 0: 1
1: 0
2: 6
3: 29
4: 348
998285624_998285634 21 Left 998285624 5:140857732-140857754 CCCGCGCTGCTGGCGTCTCCCGC 0: 1
1: 0
2: 2
3: 30
4: 173
Right 998285634 5:140857776-140857798 CAGTGAGCTGGTGCTGCGGTCGG 0: 1
1: 0
2: 4
3: 24
4: 204
998285624_998285636 30 Left 998285624 5:140857732-140857754 CCCGCGCTGCTGGCGTCTCCCGC 0: 1
1: 0
2: 2
3: 30
4: 173
Right 998285636 5:140857785-140857807 GGTGCTGCGGTCGGTGGTTGCGG 0: 1
1: 0
2: 0
3: 18
4: 285
998285624_998285629 -8 Left 998285624 5:140857732-140857754 CCCGCGCTGCTGGCGTCTCCCGC 0: 1
1: 0
2: 2
3: 30
4: 173
Right 998285629 5:140857747-140857769 TCTCCCGCTGGCAGCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 113
998285624_998285635 24 Left 998285624 5:140857732-140857754 CCCGCGCTGCTGGCGTCTCCCGC 0: 1
1: 0
2: 2
3: 30
4: 173
Right 998285635 5:140857779-140857801 TGAGCTGGTGCTGCGGTCGGTGG 0: 1
1: 0
2: 3
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998285624 Original CRISPR GCGGGAGACGCCAGCAGCGC GGG (reversed) Exonic