ID: 998285630

View in Genome Browser
Species Human (GRCh38)
Location 5:140857750-140857772
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998285630_998285638 21 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285638 5:140857794-140857816 GTCGGTGGTTGCGGGTCACGTGG 0: 1
1: 0
2: 2
3: 9
4: 86
998285630_998285634 3 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285634 5:140857776-140857798 CAGTGAGCTGGTGCTGCGGTCGG 0: 1
1: 0
2: 4
3: 24
4: 204
998285630_998285639 24 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285639 5:140857797-140857819 GGTGGTTGCGGGTCACGTGGTGG 0: 1
1: 0
2: 9
3: 14
4: 117
998285630_998285635 6 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285635 5:140857779-140857801 TGAGCTGGTGCTGCGGTCGGTGG 0: 1
1: 0
2: 3
3: 16
4: 199
998285630_998285637 13 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285637 5:140857786-140857808 GTGCTGCGGTCGGTGGTTGCGGG 0: 1
1: 0
2: 1
3: 15
4: 203
998285630_998285640 30 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285640 5:140857803-140857825 TGCGGGTCACGTGGTGGCTAAGG 0: 1
1: 0
2: 3
3: 7
4: 68
998285630_998285636 12 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285636 5:140857785-140857807 GGTGCTGCGGTCGGTGGTTGCGG 0: 1
1: 0
2: 0
3: 18
4: 285
998285630_998285633 -1 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285633 5:140857772-140857794 CAGTCAGTGAGCTGGTGCTGCGG 0: 1
1: 0
2: 6
3: 29
4: 348
998285630_998285632 -9 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285632 5:140857764-140857786 GGGCGGTGCAGTCAGTGAGCTGG 0: 1
1: 0
2: 2
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998285630 Original CRISPR GCACCGCCCGCGCTGCCAGC GGG (reversed) Exonic