ID: 998285631

View in Genome Browser
Species Human (GRCh38)
Location 5:140857751-140857773
Sequence TGCACCGCCCGCGCTGCCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 76}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998285631_998285635 5 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285635 5:140857779-140857801 TGAGCTGGTGCTGCGGTCGGTGG 0: 1
1: 0
2: 3
3: 16
4: 199
998285631_998285632 -10 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285632 5:140857764-140857786 GGGCGGTGCAGTCAGTGAGCTGG 0: 1
1: 0
2: 2
3: 16
4: 203
998285631_998285636 11 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285636 5:140857785-140857807 GGTGCTGCGGTCGGTGGTTGCGG 0: 1
1: 0
2: 0
3: 18
4: 285
998285631_998285638 20 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285638 5:140857794-140857816 GTCGGTGGTTGCGGGTCACGTGG 0: 1
1: 0
2: 2
3: 9
4: 86
998285631_998285640 29 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285640 5:140857803-140857825 TGCGGGTCACGTGGTGGCTAAGG 0: 1
1: 0
2: 3
3: 7
4: 68
998285631_998285637 12 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285637 5:140857786-140857808 GTGCTGCGGTCGGTGGTTGCGGG 0: 1
1: 0
2: 1
3: 15
4: 203
998285631_998285633 -2 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285633 5:140857772-140857794 CAGTCAGTGAGCTGGTGCTGCGG 0: 1
1: 0
2: 6
3: 29
4: 348
998285631_998285639 23 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285639 5:140857797-140857819 GGTGGTTGCGGGTCACGTGGTGG 0: 1
1: 0
2: 9
3: 14
4: 117
998285631_998285634 2 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285634 5:140857776-140857798 CAGTGAGCTGGTGCTGCGGTCGG 0: 1
1: 0
2: 4
3: 24
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998285631 Original CRISPR TGCACCGCCCGCGCTGCCAG CGG (reversed) Exonic