ID: 998285632

View in Genome Browser
Species Human (GRCh38)
Location 5:140857764-140857786
Sequence GGGCGGTGCAGTCAGTGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998285625_998285632 8 Left 998285625 5:140857733-140857755 CCGCGCTGCTGGCGTCTCCCGCT 0: 1
1: 0
2: 2
3: 13
4: 143
Right 998285632 5:140857764-140857786 GGGCGGTGCAGTCAGTGAGCTGG 0: 1
1: 0
2: 2
3: 16
4: 203
998285630_998285632 -9 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285632 5:140857764-140857786 GGGCGGTGCAGTCAGTGAGCTGG 0: 1
1: 0
2: 2
3: 16
4: 203
998285631_998285632 -10 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285632 5:140857764-140857786 GGGCGGTGCAGTCAGTGAGCTGG 0: 1
1: 0
2: 2
3: 16
4: 203
998285624_998285632 9 Left 998285624 5:140857732-140857754 CCCGCGCTGCTGGCGTCTCCCGC 0: 1
1: 0
2: 2
3: 30
4: 173
Right 998285632 5:140857764-140857786 GGGCGGTGCAGTCAGTGAGCTGG 0: 1
1: 0
2: 2
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998285632 Original CRISPR GGGCGGTGCAGTCAGTGAGC TGG Exonic