ID: 998285638

View in Genome Browser
Species Human (GRCh38)
Location 5:140857794-140857816
Sequence GTCGGTGGTTGCGGGTCACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998285631_998285638 20 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285638 5:140857794-140857816 GTCGGTGGTTGCGGGTCACGTGG 0: 1
1: 0
2: 2
3: 9
4: 86
998285630_998285638 21 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285638 5:140857794-140857816 GTCGGTGGTTGCGGGTCACGTGG 0: 1
1: 0
2: 2
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998285638 Original CRISPR GTCGGTGGTTGCGGGTCACG TGG Exonic