ID: 998285640

View in Genome Browser
Species Human (GRCh38)
Location 5:140857803-140857825
Sequence TGCGGGTCACGTGGTGGCTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998285630_998285640 30 Left 998285630 5:140857750-140857772 CCCGCTGGCAGCGCGGGCGGTGC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 998285640 5:140857803-140857825 TGCGGGTCACGTGGTGGCTAAGG 0: 1
1: 0
2: 3
3: 7
4: 68
998285631_998285640 29 Left 998285631 5:140857751-140857773 CCGCTGGCAGCGCGGGCGGTGCA 0: 1
1: 0
2: 0
3: 9
4: 76
Right 998285640 5:140857803-140857825 TGCGGGTCACGTGGTGGCTAAGG 0: 1
1: 0
2: 3
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998285640 Original CRISPR TGCGGGTCACGTGGTGGCTA AGG Exonic