ID: 998286855

View in Genome Browser
Species Human (GRCh38)
Location 5:140870852-140870874
Sequence GGTGGGTGCGGGCCACGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 2, 1: 3, 2: 3, 3: 27, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998286855 Original CRISPR GGTGGGTGCGGGCCACGTGG TGG Exonic