ID: 998286855 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:140870852-140870874 |
| Sequence | GGTGGGTGCGGGCCACGTGG TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 358 | |||
| Summary | {0: 2, 1: 3, 2: 3, 3: 27, 4: 323} |
Found 0 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
|---|
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998286855 | Original CRISPR | GGTGGGTGCGGGCCACGTGG TGG | Exonic | ||