ID: 998287495 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:140877224-140877246 |
Sequence | GGTGGGTGCGGGCCACGTGG TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 358 | |||
Summary | {0: 2, 1: 3, 2: 3, 3: 27, 4: 323} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
998287485_998287495 | 24 | Left | 998287485 | 5:140877177-140877199 | CCGGCTGGCAGCGCAGGAGGCGC | 0: 1 1: 0 2: 4 3: 24 4: 192 |
||
Right | 998287495 | 5:140877224-140877246 | GGTGGGTGCGGGCCACGTGGTGG | 0: 2 1: 3 2: 3 3: 27 4: 323 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
998287495 | Original CRISPR | GGTGGGTGCGGGCCACGTGG TGG | Exonic | ||