ID: 998287495

View in Genome Browser
Species Human (GRCh38)
Location 5:140877224-140877246
Sequence GGTGGGTGCGGGCCACGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 2, 1: 3, 2: 3, 3: 27, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998287485_998287495 24 Left 998287485 5:140877177-140877199 CCGGCTGGCAGCGCAGGAGGCGC 0: 1
1: 0
2: 4
3: 24
4: 192
Right 998287495 5:140877224-140877246 GGTGGGTGCGGGCCACGTGGTGG 0: 2
1: 3
2: 3
3: 27
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998287495 Original CRISPR GGTGGGTGCGGGCCACGTGG TGG Exonic