ID: 998292017

View in Genome Browser
Species Human (GRCh38)
Location 5:140925188-140925210
Sequence GTATCGATAATTATTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 15, 3: 46, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998292017_998292020 12 Left 998292017 5:140925188-140925210 CCAGCTTCAATAATTATCGATAC 0: 1
1: 1
2: 15
3: 46
4: 226
Right 998292020 5:140925223-140925245 TTCTACCAGAAAATATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998292017 Original CRISPR GTATCGATAATTATTGAAGC TGG (reversed) Intronic