ID: 998292017 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:140925188-140925210 |
| Sequence | GTATCGATAATTATTGAAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 289 | |||
| Summary | {0: 1, 1: 1, 2: 15, 3: 46, 4: 226} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998292017_998292020 | 12 | Left | 998292017 | 5:140925188-140925210 | CCAGCTTCAATAATTATCGATAC | 0: 1 1: 1 2: 15 3: 46 4: 226 |
||
| Right | 998292020 | 5:140925223-140925245 | TTCTACCAGAAAATATGTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998292017 | Original CRISPR | GTATCGATAATTATTGAAGC TGG (reversed) | Intronic | ||