ID: 998296434

View in Genome Browser
Species Human (GRCh38)
Location 5:140974074-140974096
Sequence ACCATGACTTCAAAAATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998296434 Original CRISPR ACCATGACTTCAAAAATCAA AGG Intronic
900575925 1:3382412-3382434 ACCAGGACCTCAAATGTCAAGGG + Intronic
900740068 1:4325704-4325726 AACATGACTTAAAAAAAAAAAGG + Intergenic
906849504 1:49233170-49233192 ACTTTGACTTCATAAATCACAGG + Intronic
912749856 1:112277881-112277903 ATCATGACTCCAGAAACCAAAGG + Intergenic
913529681 1:119724854-119724876 ACCATGACCTCACTCATCAAAGG + Intronic
917493549 1:175519338-175519360 ACCATGAGCTCAAAATTTAATGG - Intronic
917630893 1:176890422-176890444 AACTTGACTTCTAAAATCAATGG + Intronic
921951128 1:220931384-220931406 ACCAGGACTGGAAAACTCAAAGG + Intergenic
921998632 1:221450106-221450128 ACTATGTCTTGAAAAAGCAAGGG + Intergenic
922059412 1:222073433-222073455 AACATTACTTTAAAACTCAAGGG - Intergenic
923485733 1:234429161-234429183 ACCATTGCTGCCAAAATCAAGGG - Exonic
923688209 1:236168939-236168961 ATCATGACTTCATGAATCATGGG + Intronic
923942067 1:238839025-238839047 ACCCTGACTTCTAAAAGCATGGG + Intergenic
924115626 1:240743223-240743245 AAAATGACTTCAAGATTCAAAGG - Intergenic
924766676 1:247038821-247038843 AAGATGACTTCAAAAATCCTGGG - Exonic
1062990960 10:1817204-1817226 GCTATGCCTTCAAAAATGAAAGG - Intergenic
1063284122 10:4664305-4664327 ACCATTACTACATAAATAAATGG + Intergenic
1063338606 10:5241759-5241781 ACCAACACTTCAAAAATGGAAGG + Intergenic
1063474461 10:6316369-6316391 TCAATGACTTCAAAAGGCAATGG + Intergenic
1063675603 10:8138570-8138592 ACCATGACTTCTGAAAGCATTGG - Intergenic
1063822202 10:9849323-9849345 TGCATGACTTCAAAGAACAATGG + Intergenic
1065285672 10:24185439-24185461 CCCATGATTTTAAAAATCAAAGG + Intronic
1065942800 10:30580202-30580224 ACATTAACTTCAAAAAGCAAGGG + Intergenic
1066046259 10:31598138-31598160 ACCATTACTTCCAAAAGGAAAGG + Intergenic
1066242923 10:33555429-33555451 AGCATGACATCAAACAACAAAGG + Intergenic
1066874665 10:40582824-40582846 ACCATGACTCAAAAAAAAAATGG - Intergenic
1067022064 10:42809791-42809813 ACCATGTCTCAAAAAATAAAAGG - Intronic
1068746621 10:60539292-60539314 ACCATGCCAAGAAAAATCAATGG - Intronic
1069288918 10:66751928-66751950 ACATTGATTTAAAAAATCAAAGG + Intronic
1069442149 10:68438713-68438735 AACATGACTTCAGAAATAATTGG - Intronic
1069911731 10:71764003-71764025 ACAATGACTCCAAAAATCTGGGG - Intronic
1070522473 10:77266283-77266305 CACATGACTTCCAAAAACAAAGG + Intronic
1071416094 10:85442991-85443013 TCATTGACTACAAAAATCAAAGG - Intergenic
1073628820 10:105127236-105127258 ACCATGCCTTCGAAAATCAGGGG - Intronic
1073701466 10:105932112-105932134 ACCAAACTTTCAAAAATCAAGGG + Intergenic
1074727455 10:116326225-116326247 ACCCTGTCTTTAAAAATAAAAGG + Intronic
1075958255 10:126544265-126544287 ACCATGACTGTAAATATCATAGG + Intronic
1078887840 11:15523083-15523105 ATGATGACTTCCAAAACCAATGG - Intergenic
1080446260 11:32339906-32339928 ACAGTGACTTCAAAATTCAAAGG + Intergenic
1081499112 11:43647931-43647953 ACTCTGACTTCAAAAACAAAGGG - Intronic
1081823945 11:46028261-46028283 ACCATGACTTTAAAAGTTCAGGG - Intronic
1084674726 11:70627452-70627474 GCCATGGCTTAAAAAAACAAAGG - Intronic
1087953150 11:104250834-104250856 TACATAACTTGAAAAATCAAGGG - Intergenic
1089216689 11:116838298-116838320 ACCATCACTTCAAAAAGGAAAGG + Intergenic
1092575770 12:9781545-9781567 ACAGTAACTTCAAATATCAAAGG - Intergenic
1093512122 12:19941834-19941856 TCCATGTCTTCCAAAATCATTGG + Intergenic
1093836538 12:23837113-23837135 TCAATGACTTCATTAATCAAAGG - Intronic
1094097455 12:26723207-26723229 ACAATCATTTCAAAAAACAATGG + Intronic
1097518470 12:60637482-60637504 TCCATGGGTTCAGAAATCAAGGG + Intergenic
1097639497 12:62162714-62162736 TCCATGACATCAGATATCAATGG - Intronic
1099697372 12:86039867-86039889 TCACTGACTTCAAAGATCAAAGG - Intronic
1100158594 12:91831273-91831295 ACAATGTCTTCAAAATTCCAAGG + Intergenic
1101194027 12:102364328-102364350 AGCATTACTTCAAATTTCAAGGG + Intergenic
1105051407 12:133055003-133055025 TTCATGAATTCCAAAATCAAAGG + Intronic
1105898253 13:24736061-24736083 TCCAGGACTTCAAAAATTTACGG + Intergenic
1106399692 13:29417884-29417906 ACCAATACTGCAAAAATAAATGG - Intronic
1106827055 13:33534778-33534800 ACCATAACTTGAATAATAAAAGG - Intergenic
1107775580 13:43837229-43837251 ACCATGACAACAAAAATTACTGG - Exonic
1107856953 13:44625448-44625470 AACATGCCTTCAAAACTCTAAGG - Intergenic
1108012166 13:46027983-46028005 ACAATTACTTTAAACATCAATGG + Intronic
1108337825 13:49464128-49464150 CACATGACTTCAAAGATAAATGG + Intronic
1109376886 13:61507477-61507499 ACTAGGACTTCTAAAATTAAAGG + Intergenic
1110371413 13:74744942-74744964 AGCAAGTCTTCAAAAAACAATGG - Intergenic
1110485708 13:76039172-76039194 ACCATTTCTACAAAGATCAATGG + Intergenic
1110619029 13:77574550-77574572 AAAATCACTTCAAAAATCAAAGG - Intronic
1111060899 13:83017333-83017355 TTCATGAGTTCAGAAATCAAGGG - Intergenic
1111394989 13:87654408-87654430 TCCATCACTTCAAAAATCATTGG + Intergenic
1111424695 13:88064740-88064762 ACCAAGCCTACACAAATCAAGGG - Intergenic
1112757156 13:102649278-102649300 GCTAAGACTTCAAAAATCAAAGG - Intronic
1112775700 13:102842105-102842127 ACCAAGAAATCAAATATCAAGGG - Intronic
1114152968 14:20065223-20065245 ACAATGACTTCAACAGTCACAGG + Intergenic
1114899206 14:27035102-27035124 ACTTCAACTTCAAAAATCAAAGG + Intergenic
1115616118 14:35096344-35096366 ACCCTGTCTTCAAAAAGAAAAGG + Intronic
1116544493 14:46147304-46147326 ACCATTTTTTAAAAAATCAATGG + Intergenic
1117012303 14:51483390-51483412 AGCATGTGTTCAAAAATGAATGG + Intergenic
1117823812 14:59678997-59679019 ACTGTGATTTCAAAAAGCAAGGG + Intronic
1121955448 14:98208722-98208744 TGCATGACTTTTAAAATCAAGGG - Intergenic
1122761214 14:104028715-104028737 GCCAAGACTTCAAAAAGCAGAGG - Intronic
1123813217 15:23950036-23950058 AACATGATTACAAAAATCAAAGG - Intergenic
1123974471 15:25540067-25540089 ACCACCTTTTCAAAAATCAAGGG + Intergenic
1124410621 15:29433360-29433382 ACCATTAGTTCAAAAAGGAAAGG - Intronic
1125847066 15:42865908-42865930 ACAATCACTTCAAACATCAATGG + Intronic
1125895293 15:43296875-43296897 ACAATGACTTAAGAAAACAAAGG + Intronic
1126478510 15:49092600-49092622 ACCATGACTCAAAAAAAAAATGG - Intergenic
1126555841 15:49986687-49986709 AACAGGACTTTTAAAATCAAGGG + Intronic
1127129623 15:55848952-55848974 ACCATGTTTTCTAACATCAATGG + Intronic
1128826446 15:70721850-70721872 ACCATGCTGTCAAAAAACAAGGG + Intronic
1129487554 15:75889719-75889741 ATCATGCCTTAAAAAATCAAGGG - Intronic
1130860642 15:87885120-87885142 GCAATGACTTCAAAATACAATGG + Intronic
1131035985 15:89222232-89222254 AACATGACTTCAAAACTCATCGG + Intergenic
1131509073 15:93039239-93039261 ACCATGACTGGAAAGATCATGGG - Intronic
1132205996 15:99986622-99986644 ACCATGACTTAACAGACCAAGGG - Intronic
1133927219 16:10202952-10202974 ACCAAGACTTATAAAATGAAAGG - Intergenic
1134210170 16:12269717-12269739 ACACTGACTTCAAAAATAGAAGG - Intronic
1134400218 16:13903019-13903041 ACCCTGGCATTAAAAATCAAGGG - Intergenic
1134421360 16:14093081-14093103 ACACTGACTTCAAAAATTAAAGG - Intronic
1135011195 16:18880701-18880723 ACCATGTCTCCAAAAAAAAAAGG + Intronic
1135165038 16:20131608-20131630 AGCTTCACTTGAAAAATCAAAGG + Intergenic
1135266382 16:21029905-21029927 GCCATGACTTCCAGACTCAAGGG + Intronic
1137449640 16:48559449-48559471 AATATTTCTTCAAAAATCAATGG + Intronic
1140588607 16:76324376-76324398 ACCATGAGTTAAGTAATCAAGGG + Intronic
1140991665 16:80219094-80219116 ATCATGGCTTCAAAATTCCAAGG + Intergenic
1141164551 16:81651728-81651750 CCAATGACTTCAAAAAGAAAAGG - Intronic
1141918131 16:87114610-87114632 ACCATTGCTTTAAAAATCAATGG + Intronic
1142074168 16:88107888-88107910 GCCATGACATCACAAACCAAGGG - Intronic
1144022222 17:11247480-11247502 ACCATAATTTCAAAAATGGATGG - Intronic
1144405027 17:14943895-14943917 ACCATAACTTTAAAAAAAAATGG + Intergenic
1146234685 17:31147257-31147279 ATCCTGACTTCTAAAATCATGGG + Intronic
1148927541 17:51100618-51100640 ACCCTGCCTTCAAAAAAAAATGG + Intronic
1150020497 17:61607579-61607601 ACAATGAATTTAAAAATAAATGG + Intergenic
1150510565 17:65748300-65748322 ACCATCATTTCATTAATCAAGGG - Intronic
1151841104 17:76618069-76618091 ACCTTGGCTGCTAAAATCAAAGG - Intergenic
1152382821 17:79951012-79951034 ACATTTAATTCAAAAATCAAAGG + Intronic
1155362230 18:25015063-25015085 GCCATGAGTTCAAGATTCAAGGG - Intergenic
1155369428 18:25082227-25082249 ACAAAGACTTCAAAAGTCACAGG - Intronic
1156157402 18:34319471-34319493 AACATGACTTAGAAAATAAATGG - Intergenic
1156935138 18:42695526-42695548 ACCATTTCTTCAAAAATCAATGG + Intergenic
1157039818 18:44024930-44024952 ACCATCACTCAAAAAATCTATGG - Intergenic
1158020909 18:52840306-52840328 ACTATGATTGGAAAAATCAAAGG - Intronic
1158966063 18:62623304-62623326 ATCATTACTTCCAAAAGCAAGGG - Intergenic
1159216531 18:65398862-65398884 ACTATGACTGCCAAACTCAAAGG + Intergenic
1159311097 18:66710276-66710298 ACCATGAGCACAAAAATCAAAGG - Intergenic
1160095111 18:75864143-75864165 ACAAAGACCTCAAAAAGCAAGGG + Intergenic
1162695417 19:12469992-12470014 CCCATGATTACAAAATTCAAAGG + Intronic
1162885667 19:13695134-13695156 CCCATGATTTCAGAAATCCAAGG - Intergenic
1165122670 19:33570886-33570908 ACCATGGATTAAAAAACCAAAGG + Intergenic
925586695 2:5471714-5471736 ACAATGACTTCTAAGATCCATGG + Intergenic
925619041 2:5772731-5772753 TCCATGACTACAAGAATCAATGG - Intergenic
926042574 2:9685781-9685803 ACCACCACATCAAAAATGAAGGG + Intergenic
926431927 2:12796019-12796041 ACCATGACTTCAAGAAACTGTGG + Intergenic
928718726 2:34094684-34094706 ACCATGAACACAAAAATCAATGG - Intergenic
928792865 2:34979578-34979600 TGAATGACTTGAAAAATCAAGGG - Intergenic
929213897 2:39390220-39390242 AACAGGACTTTAAAAATCATTGG - Intronic
933039007 2:77437409-77437431 ACCATGGCTTAAAAAGTCAGTGG - Intronic
933567246 2:83965709-83965731 ACAGTGACCACAAAAATCAATGG - Intergenic
933654115 2:84873445-84873467 AATATTACTTCAACAATCAATGG - Intronic
933882682 2:86686540-86686562 ACCTTGTCTTCAAAAATCACTGG - Intronic
935057202 2:99578065-99578087 TCCAGGACATCAAAAAACAAAGG - Intronic
936829534 2:116626128-116626150 ACAATTACTTCAAAACTAAAAGG + Intergenic
937389248 2:121468993-121469015 ACCACAACCTCAAAGATCAAAGG - Intronic
939730201 2:145775069-145775091 ACCCTGACTTCAGAAATAAATGG + Intergenic
941039093 2:160600294-160600316 ACCATGGATTCAAAAGCCAATGG - Intergenic
941151065 2:161916209-161916231 CCCATAACTTCAAACATAAATGG - Intronic
941223893 2:162820520-162820542 ACAATGACCTCAACATTCAAGGG + Intronic
941743319 2:169059788-169059810 ACCCTGACAAAAAAAATCAATGG + Intergenic
942920775 2:181371264-181371286 ATCATGAGTTCAGAAGTCAAAGG + Intergenic
943968490 2:194370302-194370324 ACAATGATTTCATAAATTAATGG - Intergenic
947039831 2:225904370-225904392 CCCAGGACTTCAAAAATTCAAGG - Intergenic
947468338 2:230374799-230374821 ATTATGTCTTAAAAAATCAATGG - Intronic
947575594 2:231271488-231271510 ACTATGACCTCTTAAATCAAAGG + Intronic
948785463 2:240350151-240350173 GGCATAACTTCAAACATCAAGGG + Intergenic
1169002168 20:2176061-2176083 ACCATGACTTCAAGAAGCAGAGG - Intronic
1169463384 20:5816390-5816412 ACAATGATTTGAAAAATAAAAGG + Intronic
1170006479 20:11675395-11675417 ACTGAGACTTAAAAAATCAAAGG - Intergenic
1170047597 20:12101903-12101925 ACCATGACTTCTAATATTATTGG + Intergenic
1170751361 20:19149477-19149499 ATAATCACTTTAAAAATCAATGG + Intergenic
1172805373 20:37608122-37608144 ACCCTGTCTCAAAAAATCAAAGG - Intergenic
1172814510 20:37675672-37675694 TCCATGATTTCATAAATGAAAGG + Intergenic
1177532650 21:22381722-22381744 ATCATCACTTTAAATATCAATGG + Intergenic
1177780792 21:25620692-25620714 TTCATGAGTTCAAGAATCAAGGG - Intergenic
1178964446 21:37102987-37103009 ACCATGTCTAAAAAAATAAAAGG + Intronic
1179130810 21:38635746-38635768 ACCATGACCTCAAATGTCAATGG - Intronic
1179627835 21:42658541-42658563 CCCATGCCTTCTAAAATGAAAGG - Intronic
1182806570 22:33076125-33076147 CCCATGACTTCAAAAATATTAGG + Intergenic
1183511916 22:38240843-38240865 GACATGCCTTCAAAATTCAAAGG + Intronic
949345728 3:3074992-3075014 ACCAAGACTTCCAAAATTATAGG + Intronic
949459240 3:4272693-4272715 GCAATGATTACAAAAATCAAAGG + Intronic
949640323 3:6029446-6029468 TCACTGACTTCAAAGATCAAAGG - Intergenic
949705033 3:6806597-6806619 ACCATGAATTCAAAAATACTGGG + Intronic
951779037 3:26341870-26341892 ACCATGATCACCAAAATCAATGG + Intergenic
952689727 3:36191289-36191311 ACCAAAACTTCAGGAATCAATGG - Intergenic
953734331 3:45478804-45478826 ACTATGATGTCAAAAATCCAGGG - Intronic
955202435 3:56863031-56863053 ACCATGTCTTCTAACATCCAAGG + Intronic
955579095 3:60399819-60399841 ATCATGCCTTCAAAAAGAAAAGG + Intronic
956336774 3:68173793-68173815 ACAATGACTTTAAAAATGAAGGG - Intronic
956977598 3:74599759-74599781 ACCAAGCCTTCCAACATCAATGG + Intergenic
958751637 3:98198987-98199009 ACTATGATTTTAAAAACCAATGG + Intergenic
959237669 3:103745699-103745721 ATCACGAGTTCAGAAATCAAAGG - Intergenic
959625162 3:108441547-108441569 AGCATGCCTCCAAAAATCAGTGG + Intronic
959750236 3:109826163-109826185 ACCATTAGTGCAAACATCAATGG - Intergenic
960349041 3:116571646-116571668 ACCATGAGTTCAAAAAGGCAAGG + Intronic
961335315 3:126173607-126173629 AAAATCACTTCAAATATCAATGG + Intronic
963884198 3:150562057-150562079 ACCTTAACTTCAAAAAAAAAGGG - Intronic
964029763 3:152124031-152124053 GCCATGACTTCAACTATAAATGG + Intergenic
965131731 3:164708945-164708967 AGCATAGCTACAAAAATCAAGGG - Intergenic
965723813 3:171691922-171691944 AAAATGCCTTAAAAAATCAATGG - Intronic
966955943 3:184879037-184879059 ACCATCGCTCCAAAAAGCAAAGG + Intronic
967417724 3:189237566-189237588 ACCATGACTTGAACAATGAGTGG + Intronic
970017409 4:11527877-11527899 ACCATGTCTCCAAACAGCAATGG - Intergenic
970201254 4:13609300-13609322 ACAAAGTCTTCAAAAACCAAGGG - Exonic
970310923 4:14781728-14781750 AACATGATTTTAAAATTCAAGGG + Intergenic
970897788 4:21123409-21123431 ACCATGTCTTTAAAAACAAATGG - Intronic
971761350 4:30770096-30770118 ATCCTGAGTTCAAAAATGAAAGG + Intronic
972327510 4:38031317-38031339 AACATGACTTCACAAGTTAAAGG + Intronic
973734633 4:53858877-53858899 AAATTGCCTTCAAAAATCAAGGG - Intronic
974315659 4:60277333-60277355 AGAAAGACTTCAAAAATAAATGG - Intergenic
975626232 4:76350701-76350723 AACATCACTTCAAAAGGCAAAGG - Intronic
977787121 4:101049291-101049313 ACCGTTTCTTGAAAAATCAATGG - Intronic
978225771 4:106333230-106333252 ACCATGTCTCAAAAAAACAAGGG + Intronic
978381800 4:108136368-108136390 ACCAAGTATTCTAAAATCAAAGG + Intronic
981190512 4:141857035-141857057 AGCAGAAATTCAAAAATCAAGGG + Intergenic
981802561 4:148675402-148675424 ACAATGACTCCAAAGAGCAATGG - Intergenic
982890147 4:160837154-160837176 AGCATGAATTAAAAGATCAATGG - Intergenic
983706709 4:170669522-170669544 ACCACCAATTCAAAAATCTAAGG - Intergenic
984691927 4:182736092-182736114 ACCATCATATCAAAAATCCATGG + Intronic
988849170 5:35161556-35161578 AAAGTGAATTCAAAAATCAAAGG + Intronic
990917254 5:60922387-60922409 TCCATAACTTCAAAAAGAAAGGG + Intronic
992061592 5:73054198-73054220 ACAATGATTTTAAAAGTCAATGG - Intronic
993725893 5:91366049-91366071 ACCTTGACTCCAAAAAAAAAAGG + Intergenic
994038892 5:95234776-95234798 AAGCTGACTTCAAAAATAAATGG + Intronic
994899490 5:105752492-105752514 CTCATGATTTAAAAAATCAATGG - Intergenic
996252134 5:121348322-121348344 ACCATCACTATGAAAATCAAAGG - Intergenic
996703621 5:126474805-126474827 TCCATGTCTTCAAAAAACCAGGG - Intronic
998296434 5:140974074-140974096 ACCATGACTTCAAAAATCAAAGG + Intronic
999047093 5:148481255-148481277 ACAATGACTTGAAAAATCAAAGG + Intronic
999521710 5:152357696-152357718 ACCATGACTCCAAAATCCACGGG + Intergenic
1000075415 5:157780082-157780104 ACCAAGACTTCTTAAAACAAAGG - Intergenic
1000163787 5:158627260-158627282 ACCATGCCATCTAAAATCTATGG + Intergenic
1000565347 5:162840395-162840417 ACCATATTTTCAAAAATCCATGG + Intergenic
1001371997 5:171213986-171214008 ACCATTATTTAAAAATTCAAAGG + Intronic
1002117037 5:176970504-176970526 ACCATGAACTAAAAAATCCATGG + Intronic
1004687933 6:17965126-17965148 GCCAGGATTTTAAAAATCAAAGG + Intronic
1004972529 6:20927360-20927382 ACTGTGATTTCAAAAAGCAATGG + Intronic
1008141019 6:47832108-47832130 ACCAGGGCTTCAGAAATGAATGG + Intronic
1009312426 6:62170979-62171001 ACAGTGACTTCAAATATTAAAGG + Intronic
1010143882 6:72643360-72643382 ACCCTGACTTCACATACCAAAGG + Intronic
1010343007 6:74779408-74779430 ACCTTGACAACAAAAAGCAATGG - Intergenic
1011410030 6:87058364-87058386 ACCATGTCTCCAAAAGCCAATGG + Intergenic
1011600884 6:89059135-89059157 ACAATGACTTCAAAATTTCAAGG - Intergenic
1011833844 6:91405364-91405386 ATCAAAACTTCAAAAAACAATGG + Intergenic
1012660177 6:101879279-101879301 ACCATGAATTAAAACAGCAATGG - Intronic
1012684882 6:102234099-102234121 TCCATGTCTACAAAAACCAAAGG - Intergenic
1013005154 6:106065789-106065811 CCCATGACTTCCAAAATCAGGGG + Intergenic
1013258062 6:108409406-108409428 ACCATTATTACAAAAATAAATGG + Intronic
1016603082 6:145885760-145885782 ACCATGAATTCAGATATCACTGG + Exonic
1016632749 6:146251020-146251042 ACCAGAACTTCATTAATCAAAGG - Intronic
1017448727 6:154533468-154533490 ATCATTACTTTATAAATCAAAGG - Intergenic
1018023477 6:159785389-159785411 TCCATGTCTTCCAAAATCATTGG - Exonic
1018282104 6:162198165-162198187 AGCATGAATTTAAATATCAAAGG + Intronic
1018909734 6:168095126-168095148 ATCATGAATTGAAAAATCAGGGG + Intergenic
1021389835 7:20078527-20078549 ACCATTTCTGCATAAATCAAAGG - Intergenic
1021496976 7:21286024-21286046 ACCAATACTTTAAAAATTAATGG + Intergenic
1021904901 7:25323555-25323577 TTCATGACTGGAAAAATCAAAGG + Intergenic
1022708193 7:32826033-32826055 TTCATGACTTCAAGATTCAATGG - Intergenic
1022914985 7:34939485-34939507 TTCATGACTTCAAGATTCAATGG + Intronic
1023012703 7:35938005-35938027 CAGATGACTTCAAAAATCATTGG + Intergenic
1023476189 7:40580610-40580632 ATCATGACTTCACAAAGCAGAGG + Intronic
1023745106 7:43315799-43315821 ACCATGACTTCACTAAATAATGG - Intronic
1024078426 7:45835841-45835863 CAGATGACTTCAAAAATCACTGG - Intergenic
1024298702 7:47867688-47867710 ACCATATTTTTAAAAATCAAAGG + Intronic
1025779280 7:64585358-64585380 ACCCTGCCTCCAAAAATAAAAGG - Intergenic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1026564759 7:71480811-71480833 TCCTTGACTTCAGAAATCAGTGG - Intronic
1027522108 7:79222201-79222223 ACTATGTCTTAAAAAATAAATGG + Intronic
1027776431 7:82471237-82471259 ACCAGGACTTGAAGAATGAATGG + Intergenic
1028014830 7:85694887-85694909 AACATGATTTCAAAAAACAGTGG - Intergenic
1029556967 7:101277047-101277069 CAGATGACTTCAAAAATCATTGG + Intergenic
1031289216 7:119910980-119911002 GCCAAGACTTCAAAAATCACAGG - Intergenic
1031572666 7:123378142-123378164 GCAATGACTTTAAAAATAAAAGG - Intergenic
1031652503 7:124307814-124307836 ACCATCATTTAAAAAATAAATGG + Intergenic
1031673030 7:124575031-124575053 TTCAAGACTTCAAAAATCTATGG - Intergenic
1031856342 7:126927442-126927464 ATTGTGACTTTAAAAATCAAAGG + Intronic
1034526493 7:151666867-151666889 ACCATAAATTTAAAAATGAAGGG + Intronic
1035060823 7:156068141-156068163 AAGATGTCTTCAATAATCAAAGG + Intergenic
1036677485 8:10847013-10847035 AGAATGACTTCCAAAATTAAGGG + Intergenic
1036724048 8:11202758-11202780 AAAATGAGTTCAAAAATCTAGGG - Intergenic
1036973797 8:13385434-13385456 ACAATGACAACAAAAATCTAAGG + Intronic
1037181533 8:16012754-16012776 ACTATAGCTTCAAAAGTCAATGG - Intergenic
1039753903 8:40502163-40502185 ATCAATACTGCAAAAATCAAAGG + Intergenic
1041055022 8:53976193-53976215 ATCACCACTTCAAAGATCAAAGG + Intronic
1043082144 8:75780271-75780293 ACCATGACATCAAAAAATATAGG + Intergenic
1043418853 8:80078888-80078910 ACCATAACTTGGAAAATGAAAGG + Intronic
1043677849 8:82981930-82981952 ACTATGTCTTTAAAAATCATGGG - Intergenic
1044017831 8:87067462-87067484 ACAACATCTTCAAAAATCAAAGG - Intronic
1044355545 8:91218278-91218300 ACCATTATTTCAAACATAAATGG + Intronic
1045009254 8:97943479-97943501 ACCCTGTCTTAAAAAAACAAAGG - Intronic
1045298259 8:100891050-100891072 ACAAAGCCTTCTAAAATCAAGGG - Intergenic
1048078179 8:131095991-131096013 CCAAAGACTTCAATAATCAAAGG - Intergenic
1048511627 8:135067736-135067758 ACAATTACTTCAAAATTCTAAGG - Intergenic
1048821009 8:138380668-138380690 ACCAAGAATTTAAAGATCAACGG - Intronic
1050453323 9:5807270-5807292 AGCATGATTCTAAAAATCAATGG - Intronic
1050633538 9:7585444-7585466 ACAATGACTTCAAAAATCTCAGG - Intergenic
1051446556 9:17145949-17145971 ACTATGCTTTCAAAAATCCAAGG - Intronic
1051532352 9:18118912-18118934 ACTATGAATTTAAAAGTCAAGGG - Intergenic
1051536235 9:18161450-18161472 AACATTTCTTCAAAAATCCAAGG - Intergenic
1051678271 9:19580531-19580553 AGGATCACTTCAAAAATCACAGG - Intronic
1051690967 9:19711931-19711953 ACCATTATTTCAAAAAACAAGGG + Intronic
1055234059 9:74098209-74098231 AACATAACTACAAAAATAAATGG + Intergenic
1055326402 9:75135236-75135258 GCCATGCCTTCAAAATTCTAAGG - Intronic
1055520185 9:77072818-77072840 ACCATGAGTTCAAGAGTCAAAGG - Intergenic
1055624690 9:78163978-78164000 ACTATGGCTTCAAAAATCTAAGG + Intergenic
1056757870 9:89393386-89393408 ACAATGAATTCAAAAGTTAAAGG + Intronic
1057426631 9:94955849-94955871 ACCATGAGTTCATAAAAAAATGG - Intronic
1057525192 9:95792935-95792957 ACAGTGAGTTCAAAAATCAATGG - Intergenic
1058082471 9:100714518-100714540 ACCATGTCTTCAAACAACAGTGG + Intergenic
1058358874 9:104118218-104118240 ACCAGAACTTCAGAAAGCAATGG + Exonic
1059709544 9:116854975-116854997 ACCATTATTTCAGGAATCAAAGG + Intronic
1187091018 X:16096599-16096621 ACCATGTCATAAAAAATGAATGG - Intergenic
1187194603 X:17071099-17071121 ACCATGACTCCAAAAGTGATGGG + Intronic
1190519383 X:51261939-51261961 ACCATGTCTGTAAAAACCAAAGG + Intergenic
1194156888 X:90401629-90401651 ACCTTGACTTCCAAAAGCATTGG - Intergenic
1194197441 X:90912703-90912725 ACAGCGACTTCAAAAATTAAAGG + Intergenic
1198411276 X:136371862-136371884 CCCATGAATACAAAAATCCACGG - Intronic
1199063432 X:143387010-143387032 AACATGACCTCAATAACCAAAGG - Intergenic
1199900865 X:152170563-152170585 ACCTTGGCTTCCAAAATCACTGG + Intronic
1200503227 Y:3978603-3978625 ACCTTGACTTCCAAAAGCATTGG - Intergenic
1200544283 Y:4500094-4500116 ACAGTGACTTCAAAAATTAAAGG - Intergenic
1201400127 Y:13596032-13596054 TTCATGACTTCAGGAATCAAGGG - Intergenic