ID: 998298969

View in Genome Browser
Species Human (GRCh38)
Location 5:141000005-141000027
Sequence TGTCAGGCTTAGCAATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998298969_998298978 30 Left 998298969 5:141000005-141000027 CCTCCCCATTGCTAAGCCTGACA 0: 1
1: 0
2: 1
3: 12
4: 87
Right 998298978 5:141000058-141000080 GCTCTGTAGATCACAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998298969 Original CRISPR TGTCAGGCTTAGCAATGGGG AGG (reversed) Intronic
901150286 1:7096790-7096812 TTTCAGGCAAACCAATGGGGAGG - Intronic
902840651 1:19071895-19071917 TTTCCGCCTTACCAATGGGGAGG - Intergenic
915406195 1:155661478-155661500 TGTCAGGCTGGTGAATGGGGTGG + Intronic
915419402 1:155767596-155767618 TGTCAGGCTGGTGAATGGGGTGG + Intronic
915885928 1:159721050-159721072 TGCCAGGCTTTGCAATAGGCTGG - Intergenic
921005585 1:211090221-211090243 TGTCAGTCATACCAATGAGGTGG - Intronic
921119928 1:212127401-212127423 TGTCAGGCTTAACAAAGGGCGGG + Intergenic
923758615 1:236818099-236818121 ATTCAGACTTAGCAAAGGGGCGG - Intronic
1063053560 10:2478602-2478624 TGTCTGGGTTAGCAATGGGGTGG - Intergenic
1064137673 10:12764740-12764762 TGTCAAGCTTAGAAAAGGGGCGG - Intronic
1067474368 10:46556421-46556443 TCTGAGGCTCAGCAAGGGGGAGG + Intergenic
1069815520 10:71191479-71191501 TTTCAGGCTTTGCCATGGGAGGG - Intergenic
1076130557 10:128010987-128011009 TGTCATGCTTAGGACAGGGGTGG - Intronic
1076479373 10:130774900-130774922 TGTCAGGCTAAGCCCTGGGCAGG - Intergenic
1080199949 11:29657260-29657282 TGTAAAGCTTAACAATGGTGAGG + Intergenic
1080608585 11:33885127-33885149 TGTCAGACTTAGCAGTGTGCAGG + Intronic
1081639718 11:44744477-44744499 GCTCTGGCTTAGAAATGGGGGGG + Intronic
1096610529 12:52798175-52798197 GGTCATGCTTAGTCATGGGGAGG - Intergenic
1101504410 12:105332392-105332414 TGTCAGTTTTAGGGATGGGGAGG + Intronic
1102426411 12:112847717-112847739 TGTCAGGCTGACCACCGGGGTGG - Exonic
1107825760 13:44327465-44327487 TGTCAGGCCTAGAAAGGGGGTGG + Intergenic
1112095544 13:96128287-96128309 TGTGAGGCATAGCAGTGTGGTGG + Intronic
1113946651 13:114048363-114048385 TCTGAGGCTTCCCAATGGGGTGG - Intronic
1117217555 14:53567678-53567700 TGTCAGGCTAACCTGTGGGGAGG + Intergenic
1120473811 14:84961298-84961320 TGTCAGTATCAGCAATGGGGAGG - Intergenic
1121266696 14:92607997-92608019 TGTCAGGGCTAGTGATGGGGAGG + Intronic
1128078844 15:64844286-64844308 TGTCAGGCTGAGGCTTGGGGAGG + Intronic
1128475989 15:67997229-67997251 TGACAGGCTGGGCAATGGGCTGG - Intergenic
1129318663 15:74761790-74761812 TCTCAGGCAGTGCAATGGGGCGG + Intergenic
1131066118 15:89435930-89435952 TCCCAGGCTTACCACTGGGGTGG + Intergenic
1132291322 15:100705742-100705764 TGTGAGCCTTAGCACTGGGAAGG - Intergenic
1132515694 16:364774-364796 GGCCAGGCTTGGCAATGGGCTGG - Intergenic
1135481781 16:22826730-22826752 TGGCAAGCTTAGTAAAGGGGTGG - Intronic
1138344332 16:56311076-56311098 TGTAAGGCTTAGAAAAGGGAAGG - Intronic
1146510916 17:33447527-33447549 AGTGAGGCTTAGCAAGGGAGAGG + Intronic
1146530632 17:33604792-33604814 TGTCAGGCTTTTCAAAGGTGGGG + Intronic
1147543014 17:41376866-41376888 TGTCAGGCATAACAAGTGGGCGG + Intronic
1151120816 17:71790792-71790814 TGCCAGGTGTAGCAATGAGGGGG - Intergenic
1155356656 18:24960137-24960159 TGTCAAGTGAAGCAATGGGGCGG - Intergenic
1156119321 18:33822623-33822645 TGGAAGGTTTAGCTATGGGGAGG - Intergenic
1157678875 18:49588176-49588198 GGTCAGGTTTGGGAATGGGGTGG + Intronic
1160588297 18:79925234-79925256 TGTCGGGCTCAGCAGTGCGGGGG - Intronic
1162866852 19:13554532-13554554 TGTCAGGCTAATGAATGTGGTGG - Intronic
1164635149 19:29786245-29786267 GGCCAGGCTCGGCAATGGGGAGG + Intergenic
1165096390 19:33412045-33412067 TGTAAAACTTAGCAATGGGCCGG + Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1168559667 19:57372448-57372470 TGTCACCTTAAGCAATGGGGAGG + Intronic
927967343 2:27279202-27279224 TGTTAAGCTAAGGAATGGGGTGG + Intronic
932341059 2:70962934-70962956 TGTCAGGCTTAGGGAGGGGTAGG - Intronic
933276924 2:80293890-80293912 TGTCAGGCTTGGGATTGGGGTGG + Intronic
945875257 2:215271755-215271777 TGTCAGTTTTATCAATGGGGAGG - Intergenic
948118642 2:235512662-235512684 TGTTAGGATTTGCCATGGGGTGG + Intronic
1169282307 20:4278228-4278250 TGTCAGGCATAGCTGTGAGGTGG + Intergenic
1173077042 20:39829135-39829157 GGTCAGCCCTAGCAAAGGGGAGG + Intergenic
1173846786 20:46193416-46193438 TGTCAGGCTCAGCTTTGGGCTGG - Intronic
1175741595 20:61423379-61423401 GGTCAGGGTTGGCAATGAGGGGG - Intronic
1177224565 21:18237425-18237447 TGTCAGGCTTGCAAAGGGGGAGG - Intronic
1177867878 21:26534694-26534716 TTTCAGGCTTAGAAATGGCAAGG + Intronic
1178719177 21:34992890-34992912 TGTCAGGGCTAGCAATGAGGAGG + Intronic
1181681684 22:24499846-24499868 GGTTAGGCCTGGCAATGGGGAGG - Intronic
1183014929 22:34978275-34978297 TGACAGGGTTAGCGATGAGGGGG + Intergenic
1184048850 22:41989624-41989646 TGTCAGCCTTAGCAATGACAGGG - Exonic
952334452 3:32392330-32392352 GGTCAGGCTTCGCAGGGGGGTGG - Intronic
955978613 3:64501804-64501826 AGTAAGGCTTAACAATGGGGAGG + Intergenic
967080116 3:186042222-186042244 TGGCTGGATTAGCAATGTGGAGG - Intergenic
969262537 4:6043132-6043154 CGACAGCCTTAGCAATGAGGAGG - Intronic
978352838 4:107838274-107838296 TGTTGGGTTTAGCAATGTGGAGG + Intronic
981570948 4:146149832-146149854 TGGAAGGCTTAGCAATAGGCTGG - Intergenic
998267406 5:140676689-140676711 TGTGGGGCTCAGCATTGGGGTGG - Exonic
998298969 5:141000005-141000027 TGTCAGGCTTAGCAATGGGGAGG - Intronic
999684791 5:154092495-154092517 TATTAGGCTTAGGGATGGGGGGG + Intronic
1004705356 6:18119372-18119394 TATCAGGCTTGGGACTGGGGTGG - Intergenic
1006118513 6:31789460-31789482 GCTCAGGCTTAGCAAGGGTGGGG + Intronic
1006187408 6:32189264-32189286 TGTCTGGCTGAGCAGTGGAGAGG + Intronic
1007665049 6:43508995-43509017 TGTCAGCCCTAGGTATGGGGAGG + Intronic
1011423486 6:87200643-87200665 TGTCAGGCTAGGGAATAGGGAGG + Intronic
1014682719 6:124452341-124452363 TGTCATACATAGCCATGGGGTGG - Intronic
1018282836 6:162206448-162206470 AGCCAGGCTTGGCAATGTGGGGG - Intronic
1019746382 7:2702566-2702588 CGTCAGGCTTAGAAAAGGGATGG - Intronic
1022973361 7:35536714-35536736 TGTTTGGCTTGGCAATAGGGAGG - Intergenic
1028663520 7:93313213-93313235 AGTCAGGCTTGGCAAAGGGAGGG + Intronic
1033045839 7:137961631-137961653 TGTCTGGCATAGAAATGGGGAGG - Intronic
1034865622 7:154638907-154638929 TGTCATGCTTTGCAAAGGTGAGG + Intronic
1040667192 8:49648633-49648655 TATGATGCTTAGCAATGGGAGGG + Intergenic
1040947748 8:52901754-52901776 TGTGAGGCTTAACAATAGGTAGG + Intergenic
1042380133 8:68104077-68104099 TTTTAGGCTGAGCAATGGGGAGG - Intronic
1042471636 8:69196599-69196621 TGCCAGGCTGGGAAATGGGGTGG - Intergenic
1046016424 8:108610697-108610719 TGTCTGGGTTAGCAATGGAGTGG + Intronic
1050759529 9:9049979-9050001 TGTGAGTCTTTGCAATGGGAAGG + Intronic
1055981548 9:82007617-82007639 TGACAGTTTTAGCCATGGGGAGG - Intergenic
1057202097 9:93146559-93146581 TGTCATGCTTAACAATCAGGGGG - Intergenic
1058358531 9:104112202-104112224 TGGCAGGCAAAGCAATGGGGAGG - Intronic
1060268962 9:122127976-122127998 TGCCAGGCCTTGCAGTGGGGAGG + Intergenic
1062540514 9:137039878-137039900 TGTCAGGCTGGGCAGTGGGTGGG + Intronic
1187159843 X:16754095-16754117 AGTAAGAGTTAGCAATGGGGTGG - Intronic
1189867088 X:45342091-45342113 TGTGAGGCTGGTCAATGGGGAGG + Intergenic
1192164733 X:68820925-68820947 CATCAGGCTTAGCAATTGGCCGG + Intergenic
1197604458 X:128568312-128568334 TGTCAGGCAAAGCAAGGGGTAGG - Intergenic
1198799015 X:140431023-140431045 AGTCAGGCTTGGCATTGGAGGGG - Intergenic
1199326192 X:146501459-146501481 TCTCAGGCTGACCAATGAGGGGG - Intergenic
1199448411 X:147953320-147953342 TGCTAGGCTGACCAATGGGGAGG + Intergenic