ID: 998299772

View in Genome Browser
Species Human (GRCh38)
Location 5:141006646-141006668
Sequence ATGGTGTCCTGAAAGAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998299772 Original CRISPR ATGGTGTCCTGAAAGAGTGG TGG Intronic
901299616 1:8189902-8189924 ATGGCTTCGTGAAAAAGTGGAGG - Intergenic
901747040 1:11380746-11380768 ATGGGATCCTGAAAGAATAGAGG + Intergenic
904096812 1:27985430-27985452 ATGGTGTCTTGAAAGAATGAAGG - Intronic
905415927 1:37804189-37804211 ATGTTGCCCTGAAGGAGTGTGGG - Intronic
906448751 1:45925515-45925537 GTGGTGTCCTTGAAGAGAGGAGG + Intronic
907955101 1:59220748-59220770 ATTGAATCCTGAAGGAGTGGGGG + Intergenic
909949284 1:81700595-81700617 GTGGTGTCATAAAAGAGGGGAGG + Intronic
910179402 1:84464633-84464655 ATGGAGTACAGAGAGAGTGGAGG - Intergenic
912584778 1:110752480-110752502 AAGGTGACCTGAAAGAGGTGAGG + Intergenic
914192811 1:145425760-145425782 CTGGTGCCTTGAAAGAGAGGCGG - Intergenic
916514069 1:165498819-165498841 ATGGTGTCATGGAAGACTGTGGG - Intergenic
918072894 1:181146587-181146609 ATGGGGTACTGACAGAGAGGGGG - Intergenic
921320263 1:213931739-213931761 ATAGGCTCCTGAAAGAGTGGGGG - Intergenic
924727061 1:246680919-246680941 TTGCTGTCCTGAAAGAGGGTCGG - Intergenic
1063887880 10:10598105-10598127 ATGGTGTCCAGAGAGAGTTGGGG + Intergenic
1065826352 10:29575229-29575251 ATGGTTTCCTTAAACACTGGTGG - Intronic
1066228439 10:33407805-33407827 ATGGTGACCAGAGACAGTGGTGG + Intergenic
1070550053 10:77483889-77483911 GTGGTTTCCTGAAAGAGGAGGGG - Intronic
1072041221 10:91608682-91608704 ATGCTGTCTGGCAAGAGTGGCGG - Intergenic
1073077513 10:100833520-100833542 ATGGAGTCCTGGAAGAGAGGAGG + Intergenic
1073546374 10:104353118-104353140 CTGAAGTCCAGAAAGAGTGGAGG + Intergenic
1074579890 10:114708931-114708953 ATGCTGACCTGGAAGAGGGGAGG - Intergenic
1078599798 11:12719841-12719863 ATAGCCTCCTGAAAGAGGGGAGG + Intronic
1078664592 11:13314053-13314075 ATGGTGTCCTGAAGATTTGGGGG - Intronic
1079623606 11:22587310-22587332 ATGTAGTCCTGAAAGAGAGTAGG + Intergenic
1085536953 11:77227495-77227517 AGGGTGGCCTGAGAGAGGGGAGG - Intronic
1088320643 11:108551668-108551690 AAGATGTCCTTAAGGAGTGGAGG - Intronic
1095092222 12:38117981-38118003 ATGGAGACCTGAAAGCGAGGAGG + Intergenic
1095514990 12:42995665-42995687 ATGGGGTGCTGAAAGAATTGGGG + Intergenic
1096257622 12:50072872-50072894 ATGCTGTCCTGAAATAGAGCTGG + Intronic
1096549525 12:52363020-52363042 GTGGTGTCCTGAATGGATGGGGG - Intronic
1098577850 12:72064236-72064258 ATAGTAACATGAAAGAGTGGGGG - Intronic
1099039315 12:77631286-77631308 CTGGTGTCCTGAAAGAGTTAAGG - Intergenic
1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG + Intronic
1102880730 12:116482636-116482658 ATGGGGGCCTGCAGGAGTGGGGG - Intergenic
1104662414 12:130620704-130620726 CTGGTGTCCTTACAGAGAGGGGG - Intronic
1105897307 13:24727148-24727170 TTGGAGTCCTGAAGGAGTGAGGG + Intergenic
1107446299 13:40472773-40472795 CAGGTGTCCTGGAAGCGTGGGGG - Intergenic
1108026493 13:46183651-46183673 CTGGTGTCCTGAAAGAATGTAGG - Intronic
1108419235 13:50232102-50232124 ATGGGATCCTGAGAAAGTGGAGG - Intronic
1110008446 13:70301278-70301300 ATGGTGTCCTGAAACAGAAAAGG + Intergenic
1112863016 13:103857686-103857708 GTGGTGTCATTAAAGATTGGGGG + Intergenic
1112992580 13:105532102-105532124 ATGATGTGATGAAAGGGTGGAGG + Intergenic
1113059775 13:106309767-106309789 ATGGTGGCCTGAAACAGCAGAGG - Intergenic
1113948279 13:114057251-114057273 CTGGTTTCCTGAAAGACTTGAGG - Intronic
1114433956 14:22687512-22687534 TTGGTGTCCTGAAAGTGATGAGG + Intergenic
1115395682 14:32906051-32906073 AAGGAGCCCTGAAAGAGAGGAGG - Intergenic
1117037721 14:51744761-51744783 ATGGGGTCCTGAAAGAGCCAGGG - Intergenic
1118227951 14:63920691-63920713 ATGGTGTCCTGATGTAGAGGTGG + Intronic
1121521198 14:94587310-94587332 AAGGTGTCCTCAGAGAGGGGTGG - Intronic
1122935538 14:104954371-104954393 CTGGGGTCCTGGAAGAGTTGGGG - Exonic
1124187368 15:27542225-27542247 ATGGAGTTTTGCAAGAGTGGAGG - Intergenic
1124214396 15:27794422-27794444 GTTGTTTCCTGACAGAGTGGGGG - Intronic
1125956758 15:43795697-43795719 CTGCTGCCCTGAAACAGTGGAGG - Exonic
1126143517 15:45456244-45456266 ATGGTGTCCAGACAGAGGGAGGG - Intergenic
1126529069 15:49691476-49691498 AAGATTTCCTGAAAGATTGGTGG + Intergenic
1128911153 15:71516153-71516175 GTGGTGTCCTGGAAGAGGAGAGG + Intronic
1131541294 15:93277522-93277544 GTGGTATCCTGCAAGAGTGGAGG + Intergenic
1132538678 16:496998-497020 AAGGTATCCTGAAGGAGTGTTGG + Intronic
1136777707 16:32880594-32880616 ATGGCGTCCTGGAGGGGTGGAGG + Intergenic
1137276646 16:46938936-46938958 ATGCTGGCCCGAAAGACTGGGGG - Intergenic
1137537266 16:49336840-49336862 ATGGTGTCCTGTGAGGATGGCGG - Intergenic
1138939659 16:61775074-61775096 ATTGTGTCCTGATAGTGTGTTGG + Intronic
1139932001 16:70535220-70535242 AAGTTGTGCTGAAAGAGAGGAGG + Intronic
1203080123 16_KI270728v1_random:1142703-1142725 ATGGCGTCCTGGAGGGGTGGAGG + Intergenic
1143563268 17:7707521-7707543 GTGGTGGCCTGAAGGAGGGGAGG + Intronic
1144221210 17:13101451-13101473 AGGCTGTCCGGAAAGAATGGCGG - Intergenic
1146453287 17:32991308-32991330 TTGGTGCCCAGAAATAGTGGTGG - Intronic
1148289768 17:46434636-46434658 ATGGTGTCCTGAAGGAAGAGTGG - Intergenic
1148311936 17:46652208-46652230 ATGGTGTCCTGAAGGAAGAGTGG - Intronic
1149510737 17:57239340-57239362 ATGGAGACTTGAAAGAGTGAGGG + Intergenic
1152141142 17:78537474-78537496 ATACTCTCCTGAAAGAGGGGTGG + Exonic
1155522032 18:26677961-26677983 CTGGTGTCCTTAAAGAGAGCAGG + Intergenic
1155889976 18:31255599-31255621 ATGGAGTCCTGGAAGAGGGAAGG - Intergenic
1156389905 18:36640696-36640718 CTGCTGTCCTGAAAGCCTGGAGG - Intronic
1156655628 18:39282586-39282608 ATGGAGTCCTGAAGCTGTGGGGG + Intergenic
1159157532 18:64603426-64603448 ATGGTGTGAAGACAGAGTGGGGG + Intergenic
1159628656 18:70724089-70724111 ATGGTGACTTAAAAGAGTGTGGG - Intergenic
1162348917 19:10137273-10137295 CTCATGTCCTGAAAGAGTGTGGG + Exonic
925077871 2:1033622-1033644 TTGGAGTCCTGAAAAAGTTGTGG + Intronic
925837799 2:7962863-7962885 ATGGCATCCTGAAAGACTGTTGG + Intergenic
926508742 2:13746687-13746709 TTGGTGTACTGAAAGTGAGGGGG + Intergenic
927284554 2:21343221-21343243 ATGGTGTGCTGAAAGAGAAGTGG + Intergenic
928441050 2:31292438-31292460 ATGGTGTCATAAAAGAGGTGTGG - Intergenic
931839785 2:66136166-66136188 CTGGTGTCATAAAACAGTGGGGG + Intergenic
932539845 2:72640391-72640413 TTGGTGTCCTGAAAGAGATAGGG + Intronic
935278153 2:101493639-101493661 ATTGTGTCCTCACAGATTGGAGG - Intergenic
936109596 2:109654077-109654099 ATGGTGTCCTCAGACAGTGTGGG + Intergenic
937432234 2:121848655-121848677 AGGGTCACCTGAAAGGGTGGAGG - Intergenic
937792376 2:125975862-125975884 ATAGTGCCATGCAAGAGTGGTGG + Intergenic
941122243 2:161543979-161544001 TTGGTGTCATGAAAAAGTGAAGG + Intronic
942659187 2:178246136-178246158 ATGGTGACATGAAAGAGAAGTGG - Intronic
942663057 2:178286778-178286800 CTGGTGTCCAGAATGAGTGAGGG - Intronic
947693211 2:232159289-232159311 ATGGTGTCCTGCAAGAGTGGTGG - Intronic
948273366 2:236690590-236690612 ATGGTGTCCTGAACAGTTGGAGG + Intergenic
1175898618 20:62351233-62351255 GTTGTGTCCTGAAAGGTTGGGGG + Intronic
1179729502 21:43359910-43359932 ATGGAGTCCTGAGTGGGTGGTGG + Intergenic
1179839075 21:44058629-44058651 CTGGAGTCCTGAATGTGTGGTGG + Intronic
1180178675 21:46106691-46106713 ATGGTGGCCTTTCAGAGTGGTGG - Intronic
1184929535 22:47670821-47670843 TTGGTGGCCTGAAAGAGTGCAGG + Intergenic
951523759 3:23633196-23633218 GTGGTGTTCTGAGAAAGTGGCGG + Intergenic
953482260 3:43261787-43261809 ACGGGGTCCTGCAAGAGAGGAGG + Intergenic
961808531 3:129506974-129506996 ATGATGTACTGAAGGAGTAGTGG + Intronic
970681231 4:18510770-18510792 ATAGTGTCCTGACATAGTGATGG + Intergenic
978817866 4:112930056-112930078 AGGGTGTGCTGAAAGGGTAGAGG + Intronic
979280697 4:118864211-118864233 ATGCTCTCCTGAAAAATTGGTGG - Intronic
984804812 4:183742007-183742029 ATGGTTCCCTGTAGGAGTGGAGG - Intergenic
988376962 5:30449115-30449137 ATGATGTCTTGAAAGTTTGGTGG - Intergenic
988393736 5:30669704-30669726 ATGGTGCCCAGAAAGATTGCGGG - Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
989711534 5:44403318-44403340 ATGGTGTCCCAAAAGAGAGAAGG + Intergenic
989816143 5:45739976-45739998 ATGGTGTCTTGAGAGAAGGGAGG + Intergenic
991467144 5:66925652-66925674 ATGCTGTCCTGCTGGAGTGGAGG + Intronic
992208685 5:74456043-74456065 ATGGAGCCCTGACAGAATGGGGG - Intergenic
993866820 5:93205675-93205697 ATGATGTCCTGAAACAGGGTAGG + Intergenic
996437344 5:123449466-123449488 GTGTTGTCCTGTAAGAGTTGGGG - Intergenic
998299772 5:141006646-141006668 ATGGTGTCCTGAAAGAGTGGTGG + Intronic
998570136 5:143249779-143249801 ATGGTGCCATGAGAGTGTGGGGG + Intergenic
1000912993 5:167044927-167044949 ATGGTGTCCAGAGAAAATGGAGG + Intergenic
1001016955 5:168150433-168150455 ATGGCGTCCTGCCTGAGTGGTGG - Intronic
1003024304 6:2540018-2540040 TTGGTGACCTCAAAGAGTGATGG + Intergenic
1003496417 6:6667500-6667522 ATGGTGGGATGAAAGAGCGGGGG + Intergenic
1005307348 6:24526374-24526396 ATAGTGTCCTGCAAGAGTTTTGG + Intronic
1005889673 6:30126989-30127011 GTGGTGTCTTGAAAGATTGGGGG + Intergenic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1007848010 6:44776700-44776722 ATGGTGTGGAGAAAGGGTGGAGG - Intergenic
1008916715 6:56795724-56795746 ATAATGTCAAGAAAGAGTGGGGG + Intronic
1012734455 6:102921185-102921207 ATGGTCTCCTGAAAGACTAGTGG + Intergenic
1013454032 6:110313795-110313817 ATGCTGTGATGAAAGTGTGGAGG - Intronic
1014762816 6:125376532-125376554 GAGTTGTCTTGAAAGAGTGGGGG + Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1016985162 6:149889650-149889672 ATGGACTTCTCAAAGAGTGGAGG - Intronic
1022614823 7:31918782-31918804 ACGGTTTCATGAAAGAGTAGAGG + Intronic
1022940982 7:35239270-35239292 ATGGTCACCTGAAAGCGAGGTGG - Intronic
1025139396 7:56449784-56449806 GTGGTGCCCTGAAAGAGAGCAGG + Intergenic
1026438665 7:70423136-70423158 CATGTGTCCTGAAAGGGTGGTGG + Intronic
1029218350 7:98968862-98968884 AAGGTCTCCTGAACGAGTGATGG - Intronic
1029536501 7:101160591-101160613 ATGGGGTCCTGGCAGCGTGGCGG + Exonic
1029641656 7:101824387-101824409 AAGGTGTCTAAAAAGAGTGGAGG - Intronic
1031821031 7:126501807-126501829 ATGGGGTCCAGGAAGAGTCGGGG + Intronic
1032172948 7:129600892-129600914 GTAGTGTCCTTTAAGAGTGGTGG - Intergenic
1032284542 7:130530795-130530817 ATGGAGGGCAGAAAGAGTGGTGG + Intronic
1033032158 7:137837637-137837659 ATGGTGTCCTCACAGGGTGGAGG - Intronic
1033361535 7:140641395-140641417 ACGGTGTCCTGCGTGAGTGGGGG - Intronic
1036058285 8:5285389-5285411 ATGAATTCCTGAAAGAGTTGAGG + Intergenic
1036143658 8:6232047-6232069 ATAGTGGCCTGAAAAAATGGGGG - Intergenic
1040638526 8:49303985-49304007 ATGCTGGCCTCTAAGAGTGGAGG - Intergenic
1045646764 8:104307008-104307030 ATTGTGTCCTCAAAATGTGGGGG - Intergenic
1046837289 8:118816708-118816730 CTGCTGGCCTGATAGAGTGGTGG + Intergenic
1047418462 8:124685669-124685691 ATGGTGTCTTGAATGAATGTGGG - Intronic
1047448549 8:124941868-124941890 ATGGTGCCATAAAAGAGTGAAGG - Intergenic
1047543912 8:125797307-125797329 GGGTTGTCCTGAAAGAGTAGAGG + Intergenic
1047888157 8:129276238-129276260 ATGATGATCTGAAAGTGTGGAGG - Intergenic
1048830007 8:138466533-138466555 ATGCTTTCGTGGAAGAGTGGGGG + Intronic
1051387309 9:16522987-16523009 ATGATGACCTGAGAGATTGGTGG - Intronic
1055126298 9:72721640-72721662 ATGGGGTCCTGTAACAGTGCAGG + Intronic
1055211601 9:73801668-73801690 ATGGTGTAGGGATAGAGTGGTGG + Intergenic
1056740584 9:89251112-89251134 GTGGTGGCCTGAAAGGGAGGTGG - Intergenic
1057094405 9:92292699-92292721 AAGGTGACCTGAAGGAGTTGTGG - Intronic
1059735035 9:117092166-117092188 AGGGCTTCCTGAAAGAGTTGAGG - Intronic
1061386992 9:130296210-130296232 CTGCTGCCCTGGAAGAGTGGGGG + Intronic
1062372957 9:136249506-136249528 TTGGGGTCCTGGAAGAGTGTTGG - Intergenic
1185507858 X:643142-643164 CTGGTGTCCTGAAAGAGCCTTGG + Intronic
1185695508 X:2191365-2191387 ATGGCATACTGAAAGAGTGCAGG + Intergenic
1187284044 X:17885890-17885912 AAAATGTCCTGGAAGAGTGGTGG - Intergenic
1188565598 X:31522850-31522872 ATGGTAGCCTGAAATAGGGGCGG + Intronic
1189312516 X:40029799-40029821 ATGGTGTCCTTATAAAGAGGGGG + Intergenic
1192073037 X:67961414-67961436 CTGGTGTCCTTACAGGGTGGGGG - Intergenic
1193251547 X:79296960-79296982 TTGGTGTCCTGAAAGAGATGAGG + Intergenic
1197963420 X:132030637-132030659 TCTGTGTTCTGAAAGAGTGGTGG + Intergenic
1198329991 X:135613543-135613565 ATGGTGTCATGAAAGGGAGAAGG + Intergenic
1198856794 X:141026340-141026362 AGGGTGTCGTCAAAGAGTGTGGG + Intergenic
1198905899 X:141561027-141561049 AGGGTGTCGTCAAAGAGTGTGGG - Intergenic
1200108749 X:153728292-153728314 CTGGTGTCCTGACATAGTGGTGG + Intronic
1200812204 Y:7498059-7498081 ATGGTGTGCTGAAAGACCGTGGG + Intergenic