ID: 998302791

View in Genome Browser
Species Human (GRCh38)
Location 5:141041135-141041157
Sequence ACAATGCCAGAGGTGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998302791_998302801 14 Left 998302791 5:141041135-141041157 CCCCCCTCCACCTCTGGCATTGT No data
Right 998302801 5:141041172-141041194 CGCGACCCTTGGAACCAGTTGGG No data
998302791_998302800 13 Left 998302791 5:141041135-141041157 CCCCCCTCCACCTCTGGCATTGT No data
Right 998302800 5:141041171-141041193 ACGCGACCCTTGGAACCAGTTGG No data
998302791_998302798 3 Left 998302791 5:141041135-141041157 CCCCCCTCCACCTCTGGCATTGT No data
Right 998302798 5:141041161-141041183 TTAGCCAGTCACGCGACCCTTGG No data
998302791_998302803 19 Left 998302791 5:141041135-141041157 CCCCCCTCCACCTCTGGCATTGT No data
Right 998302803 5:141041177-141041199 CCCTTGGAACCAGTTGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998302791 Original CRISPR ACAATGCCAGAGGTGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr