ID: 998309148

View in Genome Browser
Species Human (GRCh38)
Location 5:141109430-141109452
Sequence GTGCTGTTATTAAGGACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998309145_998309148 -3 Left 998309145 5:141109410-141109432 CCACAACCAGGCATAAGCTGGTG 0: 1
1: 0
2: 1
3: 8
4: 96
Right 998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG 0: 1
1: 0
2: 1
3: 13
4: 168
998309146_998309148 -9 Left 998309146 5:141109416-141109438 CCAGGCATAAGCTGGTGCTGTTA 0: 1
1: 0
2: 0
3: 7
4: 101
Right 998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG 0: 1
1: 0
2: 1
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998309148 Original CRISPR GTGCTGTTATTAAGGACAAG TGG Intronic
902795430 1:18797895-18797917 ATGGTGTTATTATGGAAAAGCGG - Intergenic
905586679 1:39125276-39125298 TTGGTGTCATTAAGAACAAGGGG + Intronic
906717394 1:47980260-47980282 GAGCTGTATTGAAGGACAAGTGG - Intronic
911421658 1:97649898-97649920 GGGCTGTTAATAAGAACAGGAGG - Intronic
911831719 1:102557779-102557801 GCTCTGTTATTAAGGTCAATGGG - Intergenic
912176680 1:107166893-107166915 GTGCTGTCATTAAGTACCATGGG + Intronic
913271622 1:117099628-117099650 TTGTTGTTTTTAAAGACAAGGGG - Intronic
914743340 1:150483149-150483171 GTGCTGATCCTGAGGACAAGTGG + Intergenic
915032960 1:152899896-152899918 GTGGTGTTCTAAAAGACAAGTGG - Intergenic
916401074 1:164448956-164448978 GTGCTGATATTCAAGACAATGGG - Intergenic
916604287 1:166325779-166325801 GAGCTGTTAATAAAGTCAAGTGG + Intergenic
917461348 1:175233158-175233180 GTTCTGTTATCAAGGAAAAAGGG - Intergenic
917679986 1:177355773-177355795 GTGATGTTATTGACGACCAGGGG - Intergenic
918890623 1:190262458-190262480 GTGCTGTAACTAAGGAAAAAAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922925721 1:229345230-229345252 GTGCTGTTATAAAGGAATACCGG - Intergenic
1065122224 10:22541302-22541324 GGGCTGTTGGTAATGACAAGAGG + Intronic
1068409133 10:56632336-56632358 GTACTGTTATTAAAGATCAGTGG - Intergenic
1070066205 10:73037212-73037234 GTCCTGTCATTAAGGCCAAAAGG - Intronic
1070766901 10:79061967-79061989 GTGCTGTTTTCAAGGACACACGG - Intergenic
1071364221 10:84882672-84882694 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1073415638 10:103379439-103379461 GTTCTGTTAGTAAGGAAAAAGGG + Intronic
1073530170 10:104223595-104223617 TTGCTCTTAGTAAGGACAATTGG + Intronic
1073531462 10:104236347-104236369 GTTCTCTTATAAAAGACAAGGGG + Intronic
1074243950 10:111669136-111669158 ATGCTGTGATTAAGGTCAATGGG - Intergenic
1076370618 10:129950393-129950415 GTGTTGTTTTTAAGGGGAAGGGG + Intronic
1076572228 10:131440537-131440559 GTGCTGTTATTCAGGCTGAGCGG - Intergenic
1080019928 11:27549880-27549902 GTCCTGTGATTAAGGTCAATAGG - Intergenic
1081370740 11:42299159-42299181 GTAATGTTATAATGGACAAGAGG - Intergenic
1088191422 11:107232862-107232884 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1089966922 11:122660932-122660954 GTGAAGATATTAAGGAAAAGAGG - Intronic
1091146049 11:133281306-133281328 GTGCTGTTCTTAAGGTAATGTGG + Intronic
1091283025 11:134392704-134392726 GCGCTGTGAATAAGGACTAGGGG + Intronic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1093954744 12:25202729-25202751 GTAAATTTATTAAGGACAAGTGG + Intronic
1096129624 12:49147444-49147466 GTTCTGTTACTAAGGAAAAGAGG - Intergenic
1097111632 12:56662924-56662946 GTGCTGTGATTAAAGGCAGGTGG + Intergenic
1097441979 12:59620147-59620169 GTGCAGTTTTTAAGAAAAAGAGG - Intronic
1098001580 12:65949420-65949442 GTGCTGTTATTTGGGAGAACTGG + Intronic
1098776080 12:74619497-74619519 GTCCTGTGATTAAGGTCAATAGG + Intergenic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1100083550 12:90880024-90880046 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1100544861 12:95591798-95591820 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1101972015 12:109321376-109321398 GTGCTTTTAGTAGAGACAAGGGG - Intergenic
1102522124 12:113484951-113484973 GTGCTCTTATTAAGAAAAATAGG + Intergenic
1103277621 12:119725959-119725981 GTGTTGTTCTTAAGGCCACGGGG + Intronic
1105505309 13:21004818-21004840 TTGCTGTTTTTAAGGACAACAGG + Intronic
1106992177 13:35434427-35434449 GTTCTGTTATAAAAGAAAAGAGG + Intronic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1110704963 13:78595040-78595062 TTTCTGTTAGTAAGGACAGGGGG + Intergenic
1113139882 13:107135442-107135464 GTGATGTTATTAAGGACAGAAGG - Intergenic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1114162315 14:20182127-20182149 TTGCTGTTAGTAAGGAGAATTGG + Intergenic
1115777969 14:36737020-36737042 TTGCTGGTATTCATGACAAGTGG - Intronic
1116249291 14:42459460-42459482 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1116516145 14:45808649-45808671 GGGCTGTTACTGAGGATAAGTGG - Intergenic
1125083104 15:35698586-35698608 GAGCTGTCAGAAAGGACAAGAGG - Intergenic
1129235709 15:74222687-74222709 GGGCTTTCATTAAGGAGAAGTGG + Intergenic
1129447141 15:75626208-75626230 CTGCTTTTGTTAAGGGCAAGTGG - Intronic
1130701848 15:86191566-86191588 ATGCTGTTATCAAGAACAACTGG + Intronic
1131566854 15:93493674-93493696 GTGCTATAGTTAAGGAGAAGGGG + Intergenic
1135071646 16:19357294-19357316 GGGCAGTTATGAAGGACGAGAGG - Intergenic
1139030969 16:62879733-62879755 GTCCTGTTAATAAGGAAAAAAGG - Intergenic
1140596520 16:76421770-76421792 GGGAGGTTATTAATGACAAGGGG + Intronic
1145288015 17:21520979-21521001 ATTCTGTAATTAAGGACAAGGGG - Intergenic
1147619245 17:41853485-41853507 AAGATCTTATTAAGGACAAGTGG - Intergenic
1148264555 17:46215173-46215195 CTACTGTTATTAAAGACTAGGGG + Intronic
1149255131 17:54817268-54817290 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1151037556 17:70819796-70819818 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1151638239 17:75368178-75368200 GTGCTGGGATTAAAGATAAGAGG + Intronic
1153131021 18:1855901-1855923 GTGCTGTGATTAAGGTCAATGGG - Intergenic
1153786392 18:8538813-8538835 GTTTTGTTATTAAGGAGAAAGGG - Intergenic
1156371219 18:36473147-36473169 GTGCTGGGATTACGGACAGGTGG - Intronic
1158680125 18:59559594-59559616 GTTCTGTTATTAAACACAAGAGG - Intronic
1159580052 18:70225075-70225097 GTGCTATTATTACTGACAAATGG + Intergenic
1159743705 18:72206253-72206275 GTGCTGTTTTTAAGAGAAAGAGG - Intergenic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1164427579 19:28155773-28155795 CTGCTGTTATTCTGGGCAAGAGG + Intergenic
926173985 2:10572738-10572760 TTGCTGCTTTTAAGGAGAAGTGG - Intronic
926282080 2:11457766-11457788 TTGCTATTATTAAGTACACGTGG + Intronic
926827017 2:16915485-16915507 GTCCTGTGATTAAGGTCAATGGG + Intergenic
928054982 2:28043614-28043636 GGTCTGTTTTTAAGTACAAGGGG - Intronic
929386787 2:41417507-41417529 GTCCTGTGATTAAGGTCAATGGG - Intergenic
930480921 2:51947443-51947465 GTTCTGTGATTAAGGTCAATGGG - Intergenic
935550422 2:104447357-104447379 GTGGTGTTATTAATGATAGGAGG + Intergenic
935782144 2:106517659-106517681 GTGCTGTTATTAAAAACTATAGG - Intergenic
936888301 2:117339098-117339120 GTTCTTTTAGTAAGGAAAAGGGG + Intergenic
937581830 2:123497316-123497338 GTTCTGTGATTAAGGTCAACAGG - Intergenic
937652140 2:124331121-124331143 GTGTTGTCATTAAGGACATATGG - Intronic
938630010 2:133156250-133156272 GTGATGCTATTAATCACAAGAGG - Intronic
938972976 2:136449084-136449106 CTGCTGTTATTGAAGGCAAGTGG + Intergenic
939144339 2:138394597-138394619 CTGCTGTTATTAAAAACAAGAGG + Intergenic
939392854 2:141591237-141591259 ATGCTGTTCTTAGGGACATGGGG - Intronic
939693622 2:145296691-145296713 GAGCTGTTATTCATGACAAAGGG + Intergenic
943117978 2:183696750-183696772 GAGCTGGTATTAAGCAGAAGAGG - Intergenic
944939753 2:204610657-204610679 GTGGTTCTATGAAGGACAAGGGG - Intronic
946138220 2:217665675-217665697 GTGTTGTTATTAATGACATTTGG - Intronic
947281771 2:228463186-228463208 GTCCTGTGATTAAGGTCAAAGGG - Intergenic
947394633 2:229674577-229674599 GTGCCATTAATAAGAACAAGGGG - Intronic
948173413 2:235924750-235924772 GTGCTCTTATTAAACACATGGGG - Intronic
1169603764 20:7292115-7292137 GTGCTGTTATTGAGCACTTGTGG - Intergenic
1176081665 20:63276488-63276510 GCTCTGTTACTATGGACAAGTGG + Exonic
1179222521 21:39421351-39421373 GTGCTGGTATTACGGGCGAGAGG + Intronic
1180142919 21:45903182-45903204 GGGCTGTTGCTCAGGACAAGAGG + Intronic
1180845504 22:18979063-18979085 GTCCTGTTTTTCAGGTCAAGGGG - Intergenic
1182465876 22:30515906-30515928 GTGTGGTGATTAAGGACAAGAGG - Intergenic
1182897040 22:33867522-33867544 GTTCTATTATTCACGACAAGGGG + Intronic
1182902982 22:33914050-33914072 GTGCTGTATTTTAGGAGAAGTGG - Intronic
1185069531 22:48648398-48648420 GTGCTGTGATTGAGAACACGGGG + Intronic
952174776 3:30850038-30850060 GTCCTGATATTAAGGAAAAGGGG - Exonic
952307911 3:32161801-32161823 GCGATGTTATTAAGCACAGGTGG - Intronic
952313155 3:32208818-32208840 GTCCTGTGATTAAGGTCAATGGG - Intergenic
952878041 3:37964443-37964465 GGGCTTTTATTAAGAACAATAGG - Intronic
955218092 3:57001474-57001496 GTTCTGTTAAAAAGGACAAAAGG - Intronic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
963332799 3:143934256-143934278 GTACTGTTATTAAGAATAAATGG - Intergenic
965636976 3:170792259-170792281 GTCCTGTTACTAAGGTCAACTGG - Intronic
965929685 3:174028124-174028146 GTACTCTTTTTAAGGAAAAGAGG - Intronic
967611100 3:191506912-191506934 GTGCTGTAATTAAGGTCATCAGG - Intergenic
969076825 4:4586080-4586102 GTGCTCTTGTTAAAGACAAGGGG + Intergenic
972374069 4:38454136-38454158 GTTCCGTTACTAGGGACAAGTGG + Intergenic
976616942 4:87087605-87087627 GGGCCATTATTAAGGAGAAGAGG - Intronic
978935782 4:114373446-114373468 GCTCTGTTAATAAGGAGAAGAGG + Intergenic
979075632 4:116265850-116265872 GCCCTGTTATTAAGGTCAATGGG + Intergenic
980602460 4:135041828-135041850 GTCCTGTGATTAAGGTCAATGGG + Intergenic
983031897 4:162813310-162813332 GTGCTGTTATCAAGCAAAAGGGG + Intergenic
985147522 4:186908136-186908158 GTGGTAAAATTAAGGACAAGTGG - Intergenic
986568344 5:9138225-9138247 AGGCAGTTATAAAGGACAAGGGG + Intronic
986960080 5:13200997-13201019 GTCCTGTGATTAAGGTCAACGGG + Intergenic
988079575 5:26399594-26399616 GTTCTGTGATTAAGGTCAATGGG - Intergenic
988168969 5:27631027-27631049 GTCCTGTGATTAAGGTCAATGGG - Intergenic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
989975723 5:50584665-50584687 GTGCTGTTAGTAAAAAAAAGGGG - Intergenic
991013539 5:61909071-61909093 GTCCTGTGATTAAGGTCAATAGG - Intergenic
991100133 5:62783096-62783118 TTGCTGTTCTTAATGACCAGTGG + Intergenic
995191599 5:109323982-109324004 GTGCTCTGCTTAAGGACGAGAGG - Intergenic
998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG + Intronic
998799800 5:145857297-145857319 GTGGTGTTAAAAAGGACAAAAGG - Intergenic
1000595058 5:163205944-163205966 GTGGTGTTGTAAAGGACAAGTGG + Intergenic
1000774201 5:165396779-165396801 GTGATGTTTTTATGTACAAGGGG + Intergenic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1009857430 6:69282591-69282613 GTTTTTTTATTAAGGACAGGTGG + Intronic
1010650410 6:78448098-78448120 GTGCTGATATTTAGGACTGGAGG - Intergenic
1012522624 6:100138788-100138810 GTGCCGTCATTCAGGCCAAGAGG - Intergenic
1012821030 6:104084585-104084607 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1017298504 6:152828588-152828610 CTGCTTTTATTAATGACAGGTGG + Intergenic
1018231513 6:161680207-161680229 GTGCTCTAATTAAGGAGAAAGGG - Intronic
1023367434 7:39477516-39477538 GAGGTGTTGTTAAGGACAATAGG + Intronic
1024635769 7:51289008-51289030 GTGCTATCATTATGCACAAGTGG - Intronic
1027615963 7:80424459-80424481 GTTCTGGTAAAAAGGACAAGAGG + Intronic
1028044081 7:86093279-86093301 GTCCTGTGATTAAGGTCAATAGG + Intergenic
1029213360 7:98927274-98927296 CTGCTGTCATTAAGGACCTGCGG + Exonic
1030506938 7:110436500-110436522 GTCCTGTGATTAAGGTCAATGGG + Intergenic
1031348671 7:120701288-120701310 GTTCTGTTACTAAGGAAAATAGG + Intronic
1031768010 7:125805501-125805523 GCGCTGTGATTAAGGTCAATGGG + Intergenic
1034457227 7:151177418-151177440 GTGGTGTGGTTAAGGGCAAGGGG - Intronic
1037675475 8:21047381-21047403 GCCCTGTTATTAAGGTCAACAGG - Intergenic
1038369505 8:26973755-26973777 GTTCTTTTATTAAGTACATGGGG + Intergenic
1038795791 8:30708123-30708145 GCAGTGTTATTAAGGAAAAGCGG - Exonic
1038998888 8:32957526-32957548 GTTCTGTTATTAAGGAAAAGGGG - Intergenic
1042000812 8:64122176-64122198 GCCCTGTTATTAAGGTCAATGGG - Intergenic
1043943866 8:86228215-86228237 GTGCTGTCATTGCAGACAAGGGG + Intronic
1046284147 8:112073695-112073717 GTGCTGTTACTAAGGACTCAAGG - Intergenic
1048860666 8:138722509-138722531 TTGCTTTTTTGAAGGACAAGAGG - Intronic
1050368201 9:4892659-4892681 ATGATATTATTAAGGATAAGGGG + Intergenic
1051142336 9:13991315-13991337 GTGCTGTTATTAAAAGGAAGAGG - Intergenic
1054987785 9:71282491-71282513 GTGCTATTTTTAAAAACAAGAGG + Intronic
1057067231 9:92066713-92066735 GTGATGTTAAAAAGGAAAAGAGG + Intronic
1058658426 9:107246868-107246890 GTGCTATTGTGAATGACAAGGGG - Intergenic
1061066402 9:128280462-128280484 GTGCTATTAGAAAGGAGAAGAGG - Intronic
1062027712 9:134348112-134348134 GTGCTGTTTCTAGGGACATGAGG + Intronic
1186469505 X:9810316-9810338 GCCCTGTGATTAAGGTCAAGGGG - Intronic
1187592442 X:20733174-20733196 GTGCTGGGATTATGAACAAGAGG - Intergenic
1187811252 X:23179832-23179854 CTGCTGTCATTAAAAACAAGTGG + Intergenic
1191769261 X:64738274-64738296 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1192661341 X:73045971-73045993 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1194140606 X:90204364-90204386 GTCCTGTGATTAAGGTCAATGGG - Intergenic
1194188306 X:90802177-90802199 ATGCCCTTATTAAGGACAATAGG + Intergenic
1197419072 X:126215418-126215440 ATGGTGTTATCAAGGGCAAGAGG + Intergenic
1198161875 X:134016145-134016167 ATGCTGTTTTGAAGGGCAAGTGG + Intergenic
1198431809 X:136574879-136574901 GTGCAGTCATTCTGGACAAGGGG + Intergenic
1199928128 X:152490993-152491015 GTGCTGCTAATAAAGACATGAGG - Intergenic
1200486371 Y:3773484-3773506 GTCCTGTGATTAAGGTCAATGGG - Intergenic