ID: 998312481

View in Genome Browser
Species Human (GRCh38)
Location 5:141149190-141149212
Sequence TTGCTGTGAGAAGACGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998312479_998312481 5 Left 998312479 5:141149162-141149184 CCTGTATTTATTGGACTTGGTGT 0: 1
1: 0
2: 0
3: 15
4: 105
Right 998312481 5:141149190-141149212 TTGCTGTGAGAAGACGGTGAAGG 0: 1
1: 0
2: 3
3: 10
4: 184
998312476_998312481 16 Left 998312476 5:141149151-141149173 CCTTAATTTGGCCTGTATTTATT 0: 1
1: 0
2: 1
3: 26
4: 338
Right 998312481 5:141149190-141149212 TTGCTGTGAGAAGACGGTGAAGG 0: 1
1: 0
2: 3
3: 10
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998312481 Original CRISPR TTGCTGTGAGAAGACGGTGA AGG Intronic
900783734 1:4634375-4634397 CTGCTGTGAGTAGGCGGCGAGGG - Intergenic
903213220 1:21829986-21830008 TTGCGGTGTGAGGAAGGTGAGGG - Exonic
903936549 1:26899144-26899166 GTGCTGTGAGATGACAGAGAAGG - Intronic
904990692 1:34590348-34590370 CTGCTGTGAGATGAGGGTGGGGG - Intergenic
911453506 1:98095124-98095146 GTGCTGTGAGTAGACAGGGAAGG - Intergenic
912925888 1:113912629-113912651 TTGATCTGAGAAGAGGGAGAAGG - Exonic
913216401 1:116624314-116624336 ATGCTGTGGGAAGTCAGTGAAGG - Intronic
916073360 1:161185305-161185327 TTGTTGTGCCAAGACTGTGAGGG + Exonic
916269906 1:162929338-162929360 ATGCTGTGGGAACATGGTGATGG - Intergenic
917652697 1:177094801-177094823 TTGCTGTGAAAAGACTGTTAAGG + Intronic
919837518 1:201585290-201585312 ATTCTGTGAGAATACGATGATGG + Intergenic
922355914 1:224774857-224774879 TAGCTGTTAGAAGACTCTGAAGG + Intergenic
923859759 1:237881793-237881815 TTGCCTTGAGAAGTCAGTGATGG + Intronic
923888246 1:238181576-238181598 TTGCTGGAAGGAGGCGGTGAGGG - Intergenic
1065111571 10:22445112-22445134 GTGCTGTGAGAGCACGGTGATGG + Intronic
1067725989 10:48771454-48771476 TCACTGTGAGAAGCCTGTGAGGG - Intronic
1067902424 10:50256060-50256082 TTGCTGTGTGAACATGGTCAAGG + Intergenic
1068276309 10:54802881-54802903 TTGCTCTGAGAAGATGAGGAAGG - Intronic
1072031505 10:91526430-91526452 TGGCTGTCAGAAGATGCTGATGG + Intergenic
1074219954 10:111426792-111426814 ATGCTGGGTGAAGAGGGTGAGGG - Intergenic
1075161116 10:120025398-120025420 ATGCTCAGAGAAGAGGGTGAGGG + Intergenic
1075508825 10:123052108-123052130 TTGTTGTGAGAAGCCACTGAAGG - Intronic
1076367129 10:129928651-129928673 TTTCTGGTAGCAGACGGTGAGGG - Intronic
1078907319 11:15699694-15699716 TTGCTGTGAATAGACTGTGAAGG - Intergenic
1079410253 11:20180799-20180821 TTGCAGTGGGAAGAAAGTGATGG + Intergenic
1079720385 11:23804523-23804545 TTGCTGTTAGAAGAATTTGATGG + Intergenic
1080805992 11:35654412-35654434 TTTCTGTGGGAAGAAGTTGAGGG + Intergenic
1080957136 11:37111138-37111160 TTGCTCTGAGAAATCAGTGAGGG - Intergenic
1082683649 11:56211352-56211374 GTGCTGTGATAAGACTCTGAAGG + Intergenic
1082811736 11:57482717-57482739 TTTCTGGGAAAAGACGGGGAGGG + Intergenic
1082843085 11:57705140-57705162 ATTCTGTGGGAAGAAGGTGAAGG - Exonic
1083556788 11:63635898-63635920 TTGCTGTGAGTAGGAGGAGACGG - Intronic
1086652083 11:89304133-89304155 TTGCTGTGATGTGACAGTGAGGG - Intergenic
1090268895 11:125371798-125371820 GAGCAGTGAGAAGACAGTGAGGG + Intronic
1091236346 11:134024810-134024832 TTGCTGAGAGCAGATGGTGAGGG - Intergenic
1092459061 12:8670688-8670710 GAGCTGTGAGAAGACGGCCATGG - Intergenic
1095988727 12:48018747-48018769 TCGCTCTGAGAAAACTGTGAGGG - Intergenic
1099873161 12:88372542-88372564 TTGCTGTGAGAAGAATGAAAAGG - Intergenic
1100008864 12:89928521-89928543 TTGTTGTGATAATTCGGTGATGG - Intergenic
1104072115 12:125354881-125354903 TGGCTGTGATAACACAGTGAGGG - Intronic
1104606855 12:130195914-130195936 CTGCGGTGAGAAGACGGCCAGGG + Intergenic
1105243583 13:18628570-18628592 TGGCTGTGAGAAGGCGGCGGCGG + Intergenic
1110763171 13:79252748-79252770 ATGGTGTGAGAAGAGGCTGAAGG - Intergenic
1112009242 13:95280097-95280119 ATACTGTGAGAAGTTGGTGACGG - Intronic
1113422433 13:110180982-110181004 TTACTGTGAGAAGCAGATGAAGG - Intronic
1115715185 14:36095547-36095569 TTCCTGGGAGAAGAGGGTGAGGG - Intergenic
1116590698 14:46768219-46768241 TTACTGTGAGAGGAAGGTCAGGG - Intergenic
1119594135 14:75918095-75918117 TTTCAGTGAGAAGAGGGGGAAGG + Intronic
1119848131 14:77846247-77846269 CAGCTGTGAGAAGACGGGGGTGG - Intronic
1121011187 14:90521166-90521188 TTGCTGTGAGAAAATCGTGGAGG - Intergenic
1124577624 15:30923684-30923706 TCGCTGGCAGAAGACGGTGCCGG - Intronic
1127885910 15:63200860-63200882 TTGCTATGAAAAGACACTGATGG + Intronic
1128559481 15:68655240-68655262 TTGGTGGGAGAAAACGGTGCTGG + Intronic
1129514002 15:76145445-76145467 TTGCTCTTAGAAGACAGTGATGG - Intronic
1131149264 15:90036728-90036750 TTCCTGTGTGAAGAGGATGAGGG - Intronic
1132268597 15:100502830-100502852 TTGCTGTGGGAACAAGATGATGG + Intronic
1132957374 16:2602102-2602124 CTGCTGTGAGAATACGGTGAAGG + Exonic
1132969711 16:2680518-2680540 CTGCTGTGAGAATACGGTGAAGG + Intergenic
1134176098 16:12007691-12007713 ATGCTGTGAGATGCTGGTGATGG - Intronic
1136614615 16:31390244-31390266 TTACTGAGAGAAGACGGGCACGG + Intergenic
1140849259 16:78919448-78919470 TTGCTGTTAGAAGGTAGTGATGG - Intronic
1141440684 16:84027758-84027780 TTGCTAGGAGAATCCGGTGAGGG + Intronic
1142681266 17:1550310-1550332 GTGCTGTGAGAACACAGTGGGGG + Intronic
1145932720 17:28697600-28697622 TTCCTGTGGGAAGAAGGTAAAGG - Exonic
1146365507 17:32222790-32222812 ATGCTGTTAGCAGACGATGAGGG + Intronic
1148214669 17:45827910-45827932 TGGCTCTGAGAAGATGATGAGGG + Intronic
1152931294 17:83111526-83111548 TGCCTGAGAGAAGAGGGTGAAGG + Intergenic
1153181869 18:2444443-2444465 ATGCTATGGGAAGATGGTGAAGG + Intergenic
1154445357 18:14431312-14431334 TGGCTGTGAGAAGGCGGCGGCGG - Intergenic
1160342898 18:78104565-78104587 TTGCTGTGTGAGGATGGGGATGG + Intergenic
1160531820 18:79570031-79570053 CTGCTGTGCTGAGACGGTGAAGG - Intergenic
1160735252 19:659395-659417 TGGCGGTGAGAGGACGGTGGGGG - Intronic
1163451017 19:17377458-17377480 TGGCTGTGAGAAGGCGGGGGTGG + Intergenic
1163472999 19:17508330-17508352 TTGCTGGGAGAGGACACTGAGGG + Intergenic
1165473089 19:36014608-36014630 TTGCTGGGAGAAGACGGGAAAGG - Intergenic
1168102182 19:54147160-54147182 TTTCTGAGAGGAGACGGTGGCGG + Intronic
926109412 2:10172449-10172471 GAGCTGAGGGAAGACGGTGAAGG + Intronic
927150231 2:20191368-20191390 TTTGTGTGAGAATACGATGAGGG + Intergenic
930602101 2:53455296-53455318 TTGGTGTGATAAGAATGTGAGGG - Intergenic
931723745 2:65088464-65088486 TTGCTGTGAGAAAAGGATGGAGG + Exonic
936697038 2:114963401-114963423 TTGCTGTGAGAAGAATGCCAAGG + Intronic
942733327 2:179082604-179082626 GAGCTGTGAGAAGAGGGCGAGGG - Intergenic
943056273 2:182984782-182984804 TTACTGTGAGGAGTCTGTGATGG + Intronic
944974185 2:205029266-205029288 ATGATGTGAGTAGAGGGTGATGG - Intronic
945040270 2:205738281-205738303 TTGCTCTCTGAAGATGGTGATGG - Intronic
946809266 2:223505984-223506006 TTGCTGTGAGAATAGCATGAGGG - Intergenic
947846050 2:233244468-233244490 TTCCTGGGAGAAGACTCTGATGG - Intronic
1168887396 20:1269003-1269025 CTGGTGTGAGATGACTGTGAAGG + Intronic
1169272722 20:4212997-4213019 GTGATGTGTGAAGACGGTAAGGG - Intergenic
1173401796 20:42732556-42732578 TGACTGCGAGAAGAAGGTGAAGG + Intronic
1175306162 20:57977083-57977105 TGGCTGTCAGGAGAGGGTGAGGG - Intergenic
1175510254 20:59519307-59519329 TTGCTGTGTGATGAGCGTGAGGG - Intergenic
1176450625 21:6858547-6858569 TGGCTGTGAGAAGGCGGCGGCGG + Intergenic
1176828795 21:13723565-13723587 TGGCTGTGAGAAGGCGGCGGCGG + Intergenic
1180027637 21:45176967-45176989 TTGCTGTGGGATGAGGGTCATGG - Intronic
1180730042 22:17974275-17974297 CTGCTGTGAGAAGTAAGTGATGG + Intronic
1180817744 22:18802687-18802709 ATGCTGTGGGAAGTCAGTGAAGG - Intergenic
1181203960 22:21237140-21237162 ATGCTGTGGGAAGTCAGTGAAGG - Intergenic
1183267115 22:36835135-36835157 TTGCTGGGAAAAGACGCTCAGGG - Intergenic
1184727326 22:46354714-46354736 TTGCTGTGAGAAGACCAGAAGGG + Intronic
1203222961 22_KI270731v1_random:58275-58297 ATGCTGTGGGAAGTCAGTGAAGG + Intergenic
1203267868 22_KI270734v1_random:28538-28560 ATGCTGTGGGAAGTCAGTGAAGG - Intergenic
952244510 3:31571466-31571488 GTGCTGTGAGTAGAAGATGATGG - Intronic
953620326 3:44527260-44527282 TTGCCCTGAGAACAAGGTGAGGG + Intergenic
953796970 3:45993318-45993340 TGGCTTTGAGAAGAGGATGATGG - Intronic
955701971 3:61690625-61690647 TTGATGTGTGATGACGGAGAAGG - Intronic
958932776 3:100225381-100225403 ATGCTCTGAGGAGGCGGTGAAGG - Intergenic
961780356 3:129317082-129317104 TTCCTGTGAGAGGATGGGGAAGG + Intergenic
962356103 3:134695517-134695539 TCTCTGTGAGCAGACGGAGATGG + Intronic
963848048 3:150179961-150179983 TTGCTGAGAGAAGAAGGCTAGGG + Intergenic
965488521 3:169308058-169308080 TTGCTGTGAAATGGCAGTGAGGG - Intronic
966941871 3:184753013-184753035 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966941956 3:184753377-184753399 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966941971 3:184753432-184753454 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942001 3:184753542-184753564 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942048 3:184753740-184753762 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942080 3:184753866-184753888 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942110 3:184753976-184753998 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942161 3:184754170-184754192 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
966942216 3:184754386-184754408 GTGGTGGGAGAAGAAGGTGATGG + Intergenic
967222164 3:187256566-187256588 ATCCTGGGAGAAGAAGGTGAAGG + Intronic
969354937 4:6619764-6619786 GTGCTGTGAGAAGCAGATGAGGG + Intronic
970225831 4:13855837-13855859 TTGCTGTGAACAGACTGTTAAGG + Intergenic
972716978 4:41656236-41656258 TTGCAGTGAGAGCAGGGTGAAGG + Intronic
973247598 4:48026001-48026023 CTGCTGTGAGAGGATGGTCAAGG - Intronic
973779242 4:54272664-54272686 TAGCTGTGAGAAGAAGGTCCAGG + Intronic
973802709 4:54495016-54495038 TTGGTGTGAGAAGACCTTGCAGG + Intergenic
973852436 4:54974592-54974614 GTTCTGTCAGAGGACGGTGAGGG - Intergenic
975578811 4:75888877-75888899 TTGCTGTGTTAAGACAGTGTAGG - Intronic
976781676 4:88766216-88766238 TTGCTGTGAGCAGAGGAAGATGG + Intronic
983262569 4:165473413-165473435 TTGCTGTGTGAGGATTGTGAAGG + Intronic
985335453 4:188887960-188887982 TTGTTGTGAGAAGCAGGAGAGGG - Intergenic
985441003 4:189982441-189982463 TGGCTGTCAGAACACAGTGAAGG + Intergenic
985667172 5:1187243-1187265 TGGCTGTGAGCAGATGGTGGGGG + Intergenic
987798698 5:22665204-22665226 GTGCTGGTAGAAGATGGTGATGG - Intronic
989108105 5:37882204-37882226 TTGCTGTGAGAATATGCTGCAGG + Intergenic
991159101 5:63475292-63475314 TTTTTGTGAGAAGTGGGTGAGGG - Intergenic
992006969 5:72487680-72487702 TTGCTGTTAAAAGATGGGGAAGG + Intronic
994610180 5:102026763-102026785 TTGCTGTGGCCAGATGGTGAAGG + Intergenic
994847673 5:105010913-105010935 GTCCTGTGAGAGGACAGTGAGGG + Intergenic
995545412 5:113225277-113225299 TGGCTGTCAGAATACGTTGAGGG - Intronic
998312481 5:141149190-141149212 TTGCTGTGAGAAGACGGTGAAGG + Intronic
998473835 5:142404440-142404462 TTGCTGTGAGGAGAGGGAGATGG + Intergenic
999193642 5:149767169-149767191 TTGCTGGGAGAGGAAGGTGTGGG + Intronic
1000912861 5:167043654-167043676 TGGCAGTGGGAAGACAGTGAAGG + Intergenic
1000993743 5:167937961-167937983 TTGCTGAGTGGAGACGATGATGG - Intronic
1001335905 5:170796338-170796360 TTGCTGTGGGAACATGGGGAAGG - Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002935350 6:1666971-1666993 TTGCTCTGTGGAGACTGTGAAGG - Intronic
1003382598 6:5638591-5638613 CTGCTCTGAGAAGACTGGGATGG - Intronic
1003832170 6:10023411-10023433 TTGCTGTGTGAGGATGATGATGG - Intronic
1005598179 6:27399006-27399028 CTGCTGTGAGAAGAATGTTAGGG + Intronic
1006026679 6:31151415-31151437 ATGCTGTGAGAAGCCACTGAGGG - Intronic
1008910990 6:56733065-56733087 TTTCTGTGAGAAGAATGTGTGGG + Intronic
1014602693 6:123434452-123434474 TGGTTGTGAGAAGACAGTGCTGG + Intronic
1017964929 6:159255972-159255994 CTGCTGTGATTAGACAGTGAGGG + Intronic
1018674368 6:166206228-166206250 TGGCTGTGTGAAGACGGAGGTGG - Intergenic
1019803226 7:3103971-3103993 TTGCTGGAAGAAGCCGCTGAAGG + Intergenic
1022569328 7:31435778-31435800 TTGCAGTGAAAAGTCAGTGATGG + Intergenic
1022879023 7:34566590-34566612 ATGCTGTGGAAATACGGTGAGGG - Intergenic
1028461771 7:91102183-91102205 TTGCTCTGTGAAGAGTGTGACGG + Intronic
1031334808 7:120515225-120515247 TTGATGTGAGGTGACAGTGAAGG - Intronic
1037395410 8:18436340-18436362 CAGCTGTGTGAAGACTGTGATGG - Intergenic
1040762024 8:50859289-50859311 TTGCACTGAGAAGAAAGTGATGG - Intergenic
1041300286 8:56404368-56404390 TTGCTGTGAGCAGAGTGTTAAGG + Intergenic
1041347881 8:56920435-56920457 ATGCTGAGAGAAGACGGAGAAGG + Intergenic
1041550069 8:59090691-59090713 TTGCTGTGAGATGAGGGGAAAGG - Intronic
1042808610 8:72799125-72799147 TAGAGGTGAGAAGATGGTGATGG - Intronic
1044990088 8:97788142-97788164 TTGCTGTGGGAAGATGGTGATGG + Intronic
1045554925 8:103206751-103206773 TTCCTGGGAGAAGAGTGTGAAGG + Intronic
1046513179 8:115224331-115224353 ATGGTCTGAGAAGACTGTGAAGG - Intergenic
1047727160 8:127693995-127694017 CTGCTGTGAGAAGGAGATGAAGG - Intergenic
1049230698 8:141479781-141479803 TTGGGGTGAGAAGAAGGAGAAGG + Intergenic
1049355338 8:142184968-142184990 TTGCTGTGGGCAGAGGGTGAGGG - Intergenic
1052104770 9:24499456-24499478 TTGCTGTGAGAAGTGGGAAAAGG - Intergenic
1053060603 9:35028155-35028177 TTGCTGTGGGAAAATTGTGAGGG + Intergenic
1057353555 9:94318652-94318674 TTGCTGGCAGGAGAAGGTGATGG + Exonic
1057654196 9:96938940-96938962 TTGCTGGCAGGAGAAGGTGATGG - Exonic
1057729296 9:97594777-97594799 TTGCTGTGGGAAAACGCAGATGG - Intronic
1058328992 9:103735425-103735447 TTCCTGGGAGAAGAGGGTCAAGG - Intergenic
1059027900 9:110656941-110656963 TTCTTGTGAGAAGAAGGGGAAGG - Intergenic
1059427003 9:114227532-114227554 TTACTGTGAGCAGCTGGTGAGGG + Intronic
1203518557 Un_GL000213v1:25970-25992 TGGCTGTGAGAAGGCGGCGGCGG - Intergenic
1185682548 X:1900280-1900302 TTTCTGTGAGCACACGGTTAAGG + Intergenic
1185716438 X:2346546-2346568 TTGCTGTGAGAAGAAGCTATGGG - Intronic
1186075539 X:5874549-5874571 ATGCAGAGAGAAGAAGGTGAGGG - Intronic
1186610157 X:11131027-11131049 TTGGTGAGAGAAGAGGGGGAGGG + Intergenic
1190179270 X:48177651-48177673 GGGCTGTGAGGAGATGGTGATGG + Intergenic
1190190719 X:48274681-48274703 GGGCTGTGAGCAGATGGTGATGG + Intronic
1190198100 X:48336825-48336847 GGGCTGTGAGCAGATGGTGATGG + Intergenic
1190664857 X:52687286-52687308 GGGCTGTGAGGAGATGGTGATGG + Intronic
1190674565 X:52771133-52771155 GGGCTGTGAGGAGATGGTGATGG - Intronic
1191112251 X:56813039-56813061 TTGCTGTGAGGGGAGGGGGAGGG + Intergenic
1198878692 X:141255481-141255503 TTGCTGTGAAAATACATTGAAGG + Intergenic
1202166103 Y:21990000-21990022 TTAATGTGAGAAGAAAGTGAAGG - Intergenic
1202225255 Y:22596373-22596395 TTAATGTGAGAAGAAAGTGAAGG + Intergenic
1202317858 Y:23599288-23599310 TTAATGTGAGAAGAAAGTGAAGG - Intergenic
1202552908 Y:26070770-26070792 TTAATGTGAGAAGAAAGTGAAGG + Intergenic