ID: 998316585

View in Genome Browser
Species Human (GRCh38)
Location 5:141188680-141188702
Sequence CTCCTACACCCTGTTCGTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998316579_998316585 -7 Left 998316579 5:141188664-141188686 CCGCCTTCACCCAAACCTCCTAC 0: 13
1: 5
2: 6
3: 35
4: 382
Right 998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 84
998316573_998316585 26 Left 998316573 5:141188631-141188653 CCCTGCAGGTCTCCGACGTCAAT 0: 2
1: 6
2: 0
3: 7
4: 42
Right 998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 84
998316574_998316585 25 Left 998316574 5:141188632-141188654 CCTGCAGGTCTCCGACGTCAATG 0: 1
1: 1
2: 0
3: 3
4: 67
Right 998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 84
998316578_998316585 -6 Left 998316578 5:141188663-141188685 CCCGCCTTCACCCAAACCTCCTA 0: 11
1: 4
2: 4
3: 19
4: 400
Right 998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 84
998316575_998316585 14 Left 998316575 5:141188643-141188665 CCGACGTCAATGACAACGCCCCC 0: 10
1: 2
2: 3
3: 2
4: 48
Right 998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 84
998316580_998316585 -10 Left 998316580 5:141188667-141188689 CCTTCACCCAAACCTCCTACACC 0: 13
1: 2
2: 3
3: 37
4: 399
Right 998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 84
998316577_998316585 -5 Left 998316577 5:141188662-141188684 CCCCGCCTTCACCCAAACCTCCT 0: 9
1: 4
2: 4
3: 24
4: 340
Right 998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 84
998316576_998316585 -4 Left 998316576 5:141188661-141188683 CCCCCGCCTTCACCCAAACCTCC 0: 9
1: 4
2: 3
3: 22
4: 447
Right 998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG 0: 1
1: 0
2: 0
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998316585 Original CRISPR CTCCTACACCCTGTTCGTCC GGG Exonic
902873413 1:19327253-19327275 CTCCTACTCTCTGTTCGCGCTGG + Exonic
903221990 1:21874331-21874353 CTCCCACACCCGCTTCATCCAGG - Intronic
909922582 1:81400660-81400682 ATCCTAGACTCTGTTAGTCCAGG + Intronic
913367393 1:118055270-118055292 TTCCTACACCCAGTTAGTCTTGG + Intronic
913526369 1:119697322-119697344 CTCCTACCCCTTGTGCTTCCCGG + Intronic
916538979 1:165733525-165733547 CTCCTACAACCTCTGCCTCCCGG - Intronic
919001890 1:191843110-191843132 CTCTTACACTCTCTTCTTCCTGG - Intergenic
919669937 1:200329379-200329401 CTCCTACACCGTGGTTGTCAAGG + Intergenic
920066420 1:203272892-203272914 CCCCTTCACCCTGTTCTCCCGGG - Intronic
1063447577 10:6128979-6129001 CTCCTGCACCCTCTTCCTCAAGG - Intergenic
1064714942 10:18167063-18167085 CACCTGCACCCTGTTCTTCAAGG + Intronic
1069917904 10:71798517-71798539 CACCTACACCCTGCTGGACCTGG + Exonic
1071107999 10:82121204-82121226 CTCTTACACCCTCTTGCTCCTGG + Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1075292251 10:121240554-121240576 CTCCTAGACCCTGCCCCTCCTGG + Intergenic
1076887146 10:133268066-133268088 CTCCAACCCCCTGTTCCACCAGG - Exonic
1077669862 11:4147238-4147260 CTCCTGCACCAAGTTCTTCCTGG - Intergenic
1082036369 11:47648426-47648448 CTCCTACAACCTGTTTTTCTAGG + Intergenic
1083705606 11:64512224-64512246 CTCCTGCCCCCTGTTCCTCCAGG + Intergenic
1084064259 11:66694270-66694292 CCCCTGCACCCTGGTCCTCCTGG + Exonic
1086360841 11:86057462-86057484 CTCCTACAACCTCTGCCTCCTGG - Intronic
1089311642 11:117561980-117562002 CTCCTCCAACATGTTCCTCCTGG - Intronic
1089667714 11:120030847-120030869 CTCCTCCTCCCTGTTCCCCCAGG - Intergenic
1096197375 12:49657326-49657348 CTCCTGCACCCTGTCCCTCTTGG - Intronic
1096650480 12:53059814-53059836 CTCCTGCACCCAGTGCGGCCTGG + Exonic
1104439248 12:128781662-128781684 CTCATTCACCCGGTTCTTCCAGG - Intergenic
1104872847 12:132013047-132013069 GTCCTACACTCAGTTCTTCCGGG + Exonic
1113425920 13:110208291-110208313 CTCCCACACCCACTTGGTCCTGG + Intronic
1117424446 14:55580341-55580363 CTCCCTCACCCTGTGCGGCCGGG - Exonic
1119895947 14:78220215-78220237 CTCCTTGACCCTCTTAGTCCTGG - Intergenic
1121695487 14:95908862-95908884 CCCCTACTCCCTGTTAGTCCTGG + Intergenic
1121937823 14:98036788-98036810 CTCTTCCACCCTGTTGGTCAAGG + Intergenic
1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG + Intergenic
1124592558 15:31066166-31066188 CTCCCACACCCACTTCATCCTGG - Exonic
1126229525 15:46308913-46308935 CTCCTAGTCCCTGGTCTTCCTGG + Intergenic
1128553738 15:68615947-68615969 CTCCTCCACCCTGCTCATCTGGG - Intronic
1132414559 15:101611048-101611070 CTCCTCCCCACTGTTCCTCCAGG + Intergenic
1137930629 16:52584053-52584075 CTCCCTCACCCTGTGCCTCCAGG + Intergenic
1138315182 16:56063832-56063854 CACAAACTCCCTGTTCGTCCAGG - Intergenic
1141594854 16:85091004-85091026 CTCCTACACCCAGGTGGCCCTGG - Exonic
1157683779 18:49627010-49627032 CTCCTCAACCCTGTTTCTCCAGG + Intergenic
1160699383 19:498599-498621 CTCCTTCTCCCTGCTCGTCGGGG + Exonic
1163190762 19:15675075-15675097 CTCCCACACCCTCTCCTTCCAGG + Intronic
1168204629 19:54840510-54840532 ATCCTCCACCCTTTTCTTCCTGG + Intronic
1168365716 19:55785160-55785182 CTGCTGCACCATGTTCTTCCCGG - Intergenic
927194544 2:20538640-20538662 CTCCTGCCTCCTGTTCTTCCTGG - Intergenic
930827596 2:55709980-55710002 CTCGTACACCCTTTTCACCCTGG - Intergenic
934618265 2:95788794-95788816 CTCCCACACCCTGCCCCTCCGGG - Intergenic
934642628 2:96035765-96035787 CTCCCACACCCTGCCCCTCCGGG + Intronic
934655764 2:96116278-96116300 CTCCTAGGCCCCGCTCGTCCAGG - Intergenic
948822046 2:240554961-240554983 GTCCTACATCCAGCTCGTCCAGG - Exonic
1175344621 20:58263751-58263773 CTCCTGGACCCTGTTCGAACAGG + Intergenic
1175806759 20:61833926-61833948 CTCCTGCACCCTGTGCCTCCAGG - Intronic
1175866318 20:62179093-62179115 CTCCTACCCCCTGTCCGGGCTGG + Intronic
1178244150 21:30935730-30935752 CTCCTACACCCTGGTGCTCAGGG - Intergenic
1183521895 22:38300470-38300492 CTCCTCCGCCCTGTTGGTGCAGG - Intronic
1183620774 22:38971092-38971114 CTCCTCCACCTTGGTCGTCATGG - Intronic
949924355 3:9029135-9029157 CTCATACAGCCTGTTCGACCAGG - Intronic
961035366 3:123638060-123638082 CTGCTACATCCTGTGAGTCCTGG - Exonic
963471627 3:145748824-145748846 CTCCAACACCCTCTGAGTCCTGG - Intergenic
964227912 3:154428784-154428806 CTCCGACACCGTGTTCGGACCGG - Exonic
971384744 4:26132610-26132632 CTCATATACCCTTTTCTTCCAGG + Intergenic
979832511 4:125318370-125318392 CTTCTACTCCCTGTTGGTTCTGG + Exonic
983064795 4:163195691-163195713 GTCTTACAGCCTGTTCTTCCAGG + Intergenic
985754236 5:1703672-1703694 CACCTGCACCCTGTGCTTCCTGG - Intergenic
991546784 5:67790985-67791007 CTCCAACACCCTGCACGTCCAGG - Intergenic
992504097 5:77368409-77368431 TTCTTACACCCTGTTACTCCTGG + Intronic
992725875 5:79606837-79606859 CCCCTACACCCTCATCTTCCAGG + Intergenic
993902973 5:93596774-93596796 CTCCTGCAACCTGTTCGGCCCGG - Intergenic
998316585 5:141188680-141188702 CTCCTACACCCTGTTCGTCCGGG + Exonic
1002052404 5:176578554-176578576 CTCCTACAACATCTTCGTCCAGG + Exonic
1002314393 5:178333790-178333812 CCCCAACACCCTGTTCTACCAGG - Intronic
1005927182 6:30453406-30453428 CTCCGACGCCATGTTCTTCCTGG + Intergenic
1007345901 6:41229207-41229229 CTCCTCCACCCGGTACATCCTGG + Intronic
1007407180 6:41641845-41641867 CCCCTACTCCCTGTTGGTCCAGG + Intronic
1007783051 6:44265091-44265113 CACCTACACCCTGTCCTTGCTGG - Exonic
1007935757 6:45730414-45730436 CTCCTACTCACTGTTCCTCTGGG + Intergenic
1019226338 6:170513127-170513149 TTCCTACAATCTGTTCATCCAGG - Intergenic
1020519660 7:9169652-9169674 CCCCGACCCCCTGTGCGTCCTGG + Intergenic
1034276062 7:149824372-149824394 CACCCACACCCTGTCCTTCCAGG + Intergenic
1035426952 7:158784367-158784389 CTCCTACCCCCAGCTGGTCCAGG + Intronic
1035626853 8:1076991-1077013 CTCCTCCACCCTCTTGGTCTTGG - Intergenic
1035626869 8:1077033-1077055 CTCCTCCACCCTCTTGGTCTTGG - Intergenic
1039364437 8:36915633-36915655 CTCCTTCACCCTGTTCACACTGG + Intronic
1040855257 8:51942539-51942561 CTCCCACACCCTGTTTTGCCAGG - Intergenic
1049241850 8:141541828-141541850 CTCCTGCAGCCTCTTCCTCCCGG + Intergenic
1049522820 8:143103072-143103094 CTCCCAGACCCTGGTTGTCCAGG + Intergenic
1051874562 9:21777743-21777765 CTCCCACACCCTATGCTTCCAGG - Intergenic
1056740784 9:89253148-89253170 CTCCTACTCCCTTTTCCACCCGG + Intergenic
1057303314 9:93898855-93898877 CTCCTACACCCTGTGCTGCCAGG - Intergenic
1058383814 9:104409600-104409622 CTCCTCCACCCTTTTTTTCCAGG + Intergenic
1061414208 9:130437471-130437493 CTCCTGTACCCTATTCGTCCAGG + Intergenic
1189689340 X:43599571-43599593 CCTCTACACCCTGTTCCTACAGG - Intergenic
1193640939 X:84009006-84009028 CCCCTACCCCCTGTGCCTCCAGG - Intergenic
1194403070 X:93461718-93461740 CCCCTACCCCCTGTTGCTCCCGG - Intergenic