ID: 998316987

View in Genome Browser
Species Human (GRCh38)
Location 5:141191796-141191818
Sequence TTTTATGAGAGAATAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 462}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998316987 Original CRISPR TTTTATGAGAGAATAGAGGA GGG Intronic
900657289 1:3765100-3765122 TGTTATGAGGGTATAGAGTAAGG - Intronic
901154723 1:7127904-7127926 TTTTATGTCAGAATAGAGAACGG - Intronic
902093589 1:13923992-13924014 TTGGCTGAGAGAATAGAGAATGG + Intergenic
905027567 1:34861291-34861313 CTGTTTGAGATAATAGAGGAAGG - Intergenic
905779915 1:40699408-40699430 TTTTAAAAGAGAAGAGAGAAGGG + Intronic
906386176 1:45370543-45370565 TATTATGAGAGCACATAGGAGGG + Intronic
906420043 1:45658000-45658022 TTTTGCCAGCGAATAGAGGAAGG - Intronic
906420620 1:45663964-45663986 TTTTCTGAGACAATAGAGCAGGG + Intronic
906638920 1:47429564-47429586 ATTAATGAAAGAAAAGAGGAAGG - Intergenic
906943959 1:50279748-50279770 TGTAATGTGAGAATAGAGGAGGG - Intergenic
907197826 1:52700964-52700986 CTTGATGATAGAATAGAGCAGGG + Intergenic
910038134 1:82813466-82813488 TTTTATTAAAGCTTAGAGGAGGG - Intergenic
911592934 1:99768405-99768427 TTTAAAGAGAGAACAGAGAAAGG + Intergenic
912135101 1:106651427-106651449 TTTTATGCGAGAATGCAAGAAGG - Intergenic
912545712 1:110449876-110449898 ATTTATGAGTGCAGAGAGGAAGG - Intergenic
912721478 1:112024142-112024164 TTTAATGAAGGAAAAGAGGAAGG + Intergenic
912984151 1:114409883-114409905 TTTTAAGAGAGAAGAGAAGACGG + Intronic
913676358 1:121144628-121144650 TTTGATGAGAGAAATGAGCAGGG - Intergenic
914028253 1:143932578-143932600 TTTGATGAGAGAAATGAGCAGGG - Intergenic
914387405 1:147183590-147183612 TGTAATGAGAGCACAGAGGAAGG + Intronic
914842338 1:151258755-151258777 TTTTAAAAGAGAATACAGGCTGG - Intronic
915801619 1:158799627-158799649 TTTAATGAGAAAATAGACAAAGG + Intergenic
916164634 1:161955081-161955103 TTTTATGACAAAATAGAACATGG - Intronic
916355174 1:163897945-163897967 TTTTTAGAGAAAACAGAGGAAGG - Intergenic
917294143 1:173501749-173501771 CTTTAAGAGAGAGGAGAGGAAGG + Intronic
917403319 1:174676844-174676866 AATTATGAGAGGAAAGAGGAAGG - Intronic
917421923 1:174872959-174872981 GTTCATGAAAGATTAGAGGAGGG + Intronic
919209415 1:194460152-194460174 TTTTTCGAAAGAATGGAGGAGGG + Intergenic
919231869 1:194784148-194784170 TTTTAAGAGATAATATAGGTAGG + Intergenic
919623193 1:199885932-199885954 TTTGATGAGTGGATAGAAGAAGG - Intergenic
919774146 1:201183146-201183168 TTTTAAGAGGGAGTAGGGGAGGG - Intergenic
919960024 1:202457684-202457706 TGCTATGAGAGCATAGAGGAGGG + Intronic
920463723 1:206163469-206163491 TTTGATGAGAGAAATGAGCAGGG - Intergenic
920760196 1:208776368-208776390 TGTTAAGAGAGAATTGAAGAAGG + Intergenic
920974568 1:210773713-210773735 TATTATGGGAGCATAAAGGAGGG - Intronic
921184093 1:212655502-212655524 TGAGATGAGAGAGTAGAGGATGG + Intergenic
921438765 1:215158924-215158946 ATTGATGTTAGAATAGAGGATGG + Intronic
921961469 1:221039398-221039420 TGTCATGAAAGAACAGAGGAGGG + Intergenic
922914246 1:229242637-229242659 TTTTGTGAGCAAATAGGGGAGGG + Intergenic
923319620 1:232817971-232817993 ATTTATGAGAAAATAAGGGAGGG - Intergenic
923652487 1:235887019-235887041 TCTTATTAGAGAAGAGAGAATGG + Intergenic
923967255 1:239155775-239155797 TATTATGAGAGTATAGTGAATGG - Intergenic
924366596 1:243300289-243300311 TTTTATGACAGAATAGATATAGG - Intronic
924643305 1:245854127-245854149 TTTGATGAAAGAAGAGATGAAGG + Intronic
1063756222 10:9012215-9012237 TGTTCTGAAAGAATAAAGGAAGG + Intergenic
1063875863 10:10477694-10477716 TTTTAAGAGGGAAGAAAGGAAGG + Intergenic
1065028158 10:21558555-21558577 TTTAATTAAAGAATAGAGGTGGG + Intronic
1065073005 10:22047431-22047453 TTGTATGAGAGAAGAGAAAAGGG + Intergenic
1065710404 10:28511349-28511371 TTTTATGTGAGAAAAGAAAAAGG + Intergenic
1066508484 10:36068862-36068884 TCTTTTGAAAGAATTGAGGAGGG - Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067239565 10:44478838-44478860 TTTTATAAGAGACAAGAGGCAGG + Intergenic
1067557682 10:47284115-47284137 TCCTATGACAGAATAGTGGAGGG - Intergenic
1068302977 10:55169970-55169992 TTTACTGATAGAATAAAGGAAGG + Intronic
1068756067 10:60654813-60654835 CTCTTTGAGAAAATAGAGGAAGG - Intronic
1068875158 10:61987902-61987924 TTTTATGAGAAAAGAGAGGTAGG + Intronic
1070472300 10:76794098-76794120 TTGTTTCAGAGAATAGAAGATGG - Intergenic
1071174993 10:82916005-82916027 TTTGTTCAGAGAATGGAGGAAGG + Intronic
1071337007 10:84608679-84608701 TTATGTGAGAGAATATAGAAAGG + Intergenic
1071528813 10:86373905-86373927 TGATATGAGAGAACAGAAGAGGG + Intergenic
1071840480 10:89465698-89465720 GGTTATGATGGAATAGAGGAAGG - Intronic
1072990911 10:100192481-100192503 TTTTATGAGAGAAAAGCACATGG - Intronic
1073304098 10:102489174-102489196 TTTCATGACAGAACACAGGAAGG + Intronic
1074572661 10:114638508-114638530 TTATATGTGAGAAAAGAGGTTGG + Intronic
1074609227 10:115004762-115004784 TTTTTTGACAGAGAAGAGGAAGG - Intergenic
1075282164 10:121148570-121148592 TTCTAGGAGTGAATAGAGCATGG + Intergenic
1075394221 10:122114860-122114882 TTTTAAGAGAGAAAAGAGGACGG - Intronic
1076089728 10:127672484-127672506 TTCTATGAGAAAATACAAGAGGG + Intergenic
1076169982 10:128311223-128311245 TTTCATGTGAAAATACAGGAAGG + Intergenic
1076257648 10:129041183-129041205 TATTATGAGAGAAGAGACGGTGG - Intergenic
1077704393 11:4470554-4470576 TATTTTGCTAGAATAGAGGAAGG - Intergenic
1078422013 11:11220276-11220298 GACTATGAGAGTATAGAGGATGG + Intergenic
1078558830 11:12353310-12353332 TGTTTTGAGAGAAAAGAGAAAGG - Intronic
1079825339 11:25184175-25184197 TCTTTTGAAAGAATAGAAGATGG - Intergenic
1080710839 11:34746492-34746514 ATATATGAGTGAATAGGGGAGGG + Intergenic
1081129875 11:39365796-39365818 GTTGATGAGAAGATAGAGGAGGG + Intergenic
1081503582 11:43691540-43691562 TATTAGGAGAACATAGAGGAAGG - Intronic
1082036260 11:47647719-47647741 TTTTGGGAGAGATTATAGGAGGG - Intergenic
1083445027 11:62702637-62702659 TGTTCTGAGAGAAGGGAGGAGGG - Intronic
1084403643 11:68959014-68959036 TTTTATGAAATAATACAGCATGG - Intergenic
1085789796 11:79487137-79487159 TTATGTGAGAGGATAGAGTAGGG - Intergenic
1085936430 11:81151444-81151466 TTCTTTGAGAGAGAAGAGGAAGG + Intergenic
1086254855 11:84863518-84863540 TGTAATGAGAGAGTAAAGGAAGG - Intronic
1086473015 11:87137368-87137390 CTTTTTGTGAGAAGAGAGGAAGG + Intronic
1087198006 11:95319880-95319902 TCTTCTCAGAGAATAAAGGAAGG - Intergenic
1087538085 11:99478178-99478200 TCTTGTGAGAGACTGGAGGAAGG - Intronic
1087727204 11:101734557-101734579 TTTAAGGAGAAAATAGAAGATGG - Intronic
1087947021 11:104175089-104175111 TTTTATTAGAAAAGAGGGGAGGG - Intergenic
1088901871 11:114124383-114124405 TGCTAAGAGAGAATAGAGGGTGG - Intronic
1089216125 11:116835718-116835740 TCTTTTGGGAGAATAGAGGGGGG - Intergenic
1089860867 11:121588982-121589004 GTTTCTGAGAGACTAGAGGTTGG + Intronic
1091339687 11:134800687-134800709 TTATATGAGAGAATTGAGACAGG + Intergenic
1093028024 12:14262114-14262136 TGATATGGGAGAAAAGAGGAGGG + Intergenic
1093175376 12:15907502-15907524 TTTAATGAGAGAATAGAACATGG + Intergenic
1094096453 12:26710444-26710466 TTTTGTGAATGGATAGAGGATGG - Intronic
1094303334 12:28990413-28990435 TCTTATGTGAGAATAGAGTCAGG + Intergenic
1095125890 12:38476687-38476709 TTTTATGAGAAAGTAGATGTGGG - Intergenic
1095578302 12:43764707-43764729 TTTGATGAGAGAAAAGAGCAGGG + Intronic
1095877162 12:47092383-47092405 ATTAATAAGAGAATATAGGAAGG - Intronic
1096753633 12:53780690-53780712 TGCTATGAGAGGATATAGGAAGG + Intergenic
1097489726 12:60251060-60251082 TGTTCTGAAAGCATAGAGGAAGG + Intergenic
1099479317 12:83146211-83146233 CATTATGGGAGAACAGAGGATGG - Intergenic
1099536183 12:83847853-83847875 TAATATGAGTGAAAAGAGGAGGG + Intergenic
1100243631 12:92734669-92734691 TCTAATGAGAGAATGGAGGGAGG - Intronic
1101452128 12:104789375-104789397 TTTTAAAAAAGAAAAGAGGAAGG - Intergenic
1103142329 12:118559588-118559610 TTTTATGGGAGTATAGAAGAGGG + Intergenic
1104604457 12:130177652-130177674 TTTTATGAGAAAACAAAAGATGG - Intergenic
1105497731 13:20945426-20945448 TTTAATGAAGGAACAGAGGAAGG + Intergenic
1105793006 13:23821356-23821378 TTTTATGAAAGAAACTAGGAAGG - Intronic
1105795117 13:23843966-23843988 GTTTGTGGGAGAAGAGAGGAGGG + Intronic
1107101482 13:36598040-36598062 ATATATAAGAGAATACAGGAGGG + Intergenic
1107732699 13:43364783-43364805 TTTGAGGAGAGGATAAAGGATGG + Intronic
1108811251 13:54225966-54225988 TTTTATTATAGAATAAAGCAAGG + Intergenic
1108856695 13:54801258-54801280 GTTTATTAGAAAATAAAGGAGGG - Intergenic
1109272655 13:60271792-60271814 TTCAGTGAGAGAATAGAGGAAGG + Intergenic
1110018399 13:70438086-70438108 TTTAAAAAGAAAATAGAGGATGG + Intergenic
1110255360 13:73427658-73427680 TTTTTTGATAAAATAGATGAAGG + Intergenic
1110416636 13:75260731-75260753 TTTATTGAGAGAATAAAGGATGG - Intergenic
1110512891 13:76373873-76373895 TTTGATGATAGAATAGAGGATGG + Intergenic
1111175787 13:84594793-84594815 TTTGGAGAGAAAATAGAGGAAGG + Intergenic
1111693155 13:91590808-91590830 GTTTATAAGACAATAAAGGATGG - Intronic
1111696786 13:91634340-91634362 TTTTATGGGGGAATGGGGGATGG + Intronic
1111893373 13:94110540-94110562 CTTTAAGACAGAATGGAGGAGGG + Intronic
1111927968 13:94483355-94483377 TTTGATGAAAGAATTGGGGAAGG - Intergenic
1112050221 13:95637976-95637998 TTTTCTCTGAGAATCGAGGAAGG + Intronic
1112519511 13:100083183-100083205 TTTTCTGGGAGAAAAGTGGAAGG - Intergenic
1112649051 13:101371575-101371597 TATTTTGGGGGAATAGAGGATGG - Intronic
1112732952 13:102387298-102387320 TTTTATAACAGAAAAGAGTAAGG + Intronic
1113817224 13:113181336-113181358 TTTTTTGAGATAATAAAGGGAGG - Intronic
1115053254 14:29091093-29091115 TTTTAGTAGAGATTAGAGCAGGG + Intergenic
1115148428 14:30254542-30254564 TATGATCAGAGAATAAAGGAGGG - Intergenic
1115213523 14:30991912-30991934 TTTTTTTAAAGAATAGAGAAGGG - Intronic
1115848772 14:37570054-37570076 TTGAATGAGACAATAGAGGGGGG + Intergenic
1115902235 14:38164556-38164578 TTTTTTGAAAGAAAAGAGGGAGG + Intergenic
1116252591 14:42505873-42505895 TTTTGTGAAAGAATAAAGGCTGG - Intergenic
1116385691 14:44326994-44327016 TTTTATGATAGAAGAGACCATGG + Intergenic
1117266135 14:54088963-54088985 TGTTATGAGAGCAAAGAAGAAGG - Intergenic
1119675611 14:76551279-76551301 TTTTTTGAGAGCACAGAGGAGGG - Intergenic
1120279943 14:82426587-82426609 TTTTATAAGAAAATAGATGATGG - Intergenic
1120286616 14:82510442-82510464 GTTTATGAGAGCACAGAGTACGG - Intergenic
1121484421 14:94303750-94303772 TTTTATTAGGGAAGAGGGGAGGG + Intergenic
1121538632 14:94708455-94708477 TTTAAGGAGAGAAATGAGGATGG + Intergenic
1126030079 15:44488326-44488348 TTGTATTAGAGAAGACAGGAAGG + Intronic
1126528103 15:49680435-49680457 TACTATGAGAGCATAGAGAAGGG - Intergenic
1127700139 15:61491046-61491068 TATTAAGACAGAATAGAGGAGGG - Intergenic
1128500655 15:68225171-68225193 TATAATGAGAGAATAAAGAAAGG + Intronic
1130719112 15:86369195-86369217 TTTTATGAGAAATTACAGAAAGG + Intronic
1130793122 15:87177889-87177911 TTTTGTGAGAGAAGAGAAAAAGG + Intergenic
1131605411 15:93898751-93898773 TTTTATGAGGGGATGTAGGAGGG - Intergenic
1132004831 15:98217726-98217748 TTCTATGAAAGAAAAGAGCAGGG + Intergenic
1133172972 16:3993076-3993098 GTTTATGAGAGAATATAGACGGG - Intronic
1135112377 16:19700243-19700265 TTTTTTGAGGGATGAGAGGAGGG - Intronic
1135684929 16:24491274-24491296 TTTTATGGGGTAATAGAGAAGGG - Intergenic
1137469977 16:48745478-48745500 TTTTTTTAGAAAATGGAGGAAGG + Intergenic
1137942306 16:52700139-52700161 TTTTGTAAGAGAAGAGAGGGTGG - Intergenic
1138595653 16:58027685-58027707 TTTAATAAAAGCATAGAGGAAGG + Intronic
1139133406 16:64173192-64173214 TTTTATGTGAGACTATAGCAGGG - Intergenic
1139240454 16:65386413-65386435 TTGTGTGAGAGAAGATAGGATGG - Intergenic
1139364474 16:66425532-66425554 TTTTATGAATGAATAAATGAAGG - Intergenic
1140156412 16:72432139-72432161 CTTTTTCAGAGTATAGAGGAGGG - Intergenic
1141585320 16:85029640-85029662 CTTTATGAGAGAAAGGAGGGAGG - Intronic
1144071408 17:11674781-11674803 TTTTAGAAGAGAATACAGGAGGG - Intronic
1145727894 17:27149491-27149513 TTTTATTGTAGAATATAGGAAGG + Intergenic
1145922791 17:28623390-28623412 TTTCATGAGAGGACAGAGAAAGG + Intronic
1146256963 17:31397269-31397291 GTGTATGAGAGAACAGGGGATGG + Intronic
1146411099 17:32586039-32586061 TTTTAAGACAGGTTAGAGGACGG + Intronic
1148232731 17:45946929-45946951 TTGTATGAGGGCATAGATGAAGG - Intronic
1148525175 17:48325351-48325373 TCATATGAGAGCATAGTGGAAGG - Intronic
1148631801 17:49116352-49116374 TTTAATGAAAGAATTGATGATGG + Intergenic
1149283384 17:55132782-55132804 TTTTATGAGTGACTAGGGAAGGG + Intronic
1149504999 17:57186875-57186897 TTGAATGAGAGAATAAAGGAAGG + Intergenic
1150951849 17:69811693-69811715 TATTATGAGAGTACATAGGAAGG + Intergenic
1155407590 18:25506255-25506277 TTGTATGAAAGAATGAAGGAAGG - Intergenic
1155625899 18:27834199-27834221 TTTAAGGACAGGATAGAGGATGG - Intergenic
1157090456 18:44630751-44630773 TTTTATTACAAAATAGAAGATGG + Intergenic
1157345144 18:46822730-46822752 TTATATGAGAAACTGGAGGAAGG + Intronic
1158066964 18:53422257-53422279 TTTTATTGTGGAATAGAGGAAGG - Intronic
1158296198 18:55999388-55999410 TTTAAAGAAAGAATTGAGGAAGG + Intergenic
1158761105 18:60388073-60388095 TTTTAAGAGTAAATAGAGGAAGG + Intergenic
1158830392 18:61271100-61271122 TTTTTTGAAAGTGTAGAGGAGGG - Intergenic
1159086862 18:63802394-63802416 TTTAATGAGAGAATAGAGAAGGG - Intronic
1159306736 18:66652892-66652914 TTGTTTGAGAGAATAGTGGTTGG - Intergenic
1159370198 18:67518571-67518593 ATTTATGAGAGAGTAGAGTTGGG + Intergenic
1159751974 18:72314017-72314039 TTTGAAGAGACAACAGAGGAAGG + Intergenic
1160255395 18:77243860-77243882 TTTTCTGCGAGTATAGAGGGAGG + Intergenic
1160488776 18:79319380-79319402 TAATGTGAGTGAATAGAGGAGGG + Intronic
1162011472 19:7818341-7818363 TTTAATGAGTGAATGGAGGCTGG + Intergenic
1164736746 19:30546681-30546703 TTTTACAATAGAACAGAGGAAGG + Intronic
1165639941 19:37376029-37376051 GTTTAAGAGAGAATGGAGGCCGG + Intronic
1166651225 19:44576643-44576665 TTATAAGAGAGAGAAGAGGAAGG + Intergenic
1167065279 19:47180961-47180983 TTGGATCTGAGAATAGAGGAAGG + Intronic
926457696 2:13088381-13088403 ATTTATGACAGAATAAAAGAAGG - Intergenic
926473858 2:13297219-13297241 TTTTCTGGCAGAATATAGGAAGG - Intergenic
926993808 2:18711614-18711636 TTTGATGAGAGAAATGAGCAGGG + Intergenic
927333612 2:21894648-21894670 TTTTATGGGAGGATAGAAGAAGG + Intergenic
927733764 2:25499617-25499639 TACTATGAGAGAATATAGCAGGG - Intronic
928730428 2:34225523-34225545 TTTAAACAGAGAATAGAAGAAGG + Intergenic
929450650 2:42034872-42034894 ATATATGAGATAATATAGGAAGG + Intergenic
929845932 2:45527385-45527407 TTTTAGGAGAGCACAGATGAGGG + Intronic
929992030 2:46798375-46798397 TTGAAAGAGAGAATAGAGAAGGG + Intergenic
930625655 2:53694592-53694614 TATTTTGAAAGAACAGAGGAAGG - Intronic
931179328 2:59884044-59884066 GCTTATGATAGAATAGATGAGGG - Intergenic
932398642 2:71464988-71465010 GTTCAAGAGAGAATGGAGGAGGG + Intronic
933294559 2:80474361-80474383 TTTAAGGAGAGAATGGAGGTGGG + Intronic
933342824 2:81044301-81044323 TTTTATCACAGAATAGAGCTTGG + Intergenic
933678922 2:85081429-85081451 TATTATTAGAAACTAGAGGAAGG - Intergenic
933951143 2:87331487-87331509 TTTTAGAAGAAAATATAGGAGGG + Intergenic
935412988 2:102785356-102785378 TATTATGCCAGAATAGAGAAAGG - Intronic
935528407 2:104201480-104201502 TTATATGAGATAAAAGAGAAGGG - Intergenic
935640204 2:105282954-105282976 TTTTGTAAGAGAATAGATGTGGG - Intronic
935719527 2:105967856-105967878 TTTAATGTGTGAATAGAGGCAGG + Intergenic
935947548 2:108300080-108300102 TTAAATGAGAGAGTAGAGGCCGG + Intronic
936328635 2:111527091-111527113 TTTTAGAAGAAAATATAGGAGGG - Intergenic
936444167 2:112583362-112583384 TTTGATGGGAGAAGAGGGGAAGG - Intergenic
936607410 2:113972379-113972401 TTTTTTCATGGAATAGAGGAGGG + Intergenic
936672119 2:114668790-114668812 TCCTATCAGAGAATAGAGGAGGG - Intronic
937623811 2:124021680-124021702 ATTTTTGATAGAATAGGGGAGGG + Intergenic
938925611 2:136038852-136038874 TGTTTAGAGAGAAGAGAGGATGG - Intergenic
939531831 2:143372968-143372990 TTTTTTAAGAGGAGAGAGGATGG - Intronic
942549613 2:177101460-177101482 TTGTATGATATAATGGAGGAAGG - Intergenic
942668207 2:178344991-178345013 TTTTCTGAGAGAAAATAGAATGG + Intronic
942686874 2:178542019-178542041 TCTTATGAAAGAGAAGAGGAGGG - Intronic
943043689 2:182832719-182832741 TTTTATTGGGGAAGAGAGGAAGG + Intergenic
944446012 2:199790064-199790086 TTTTATGAAAGCAAAGAGGGTGG + Intronic
945029170 2:205647810-205647832 TATTTTGAGAGGATAAAGGAAGG - Intergenic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
946667774 2:222068699-222068721 TTAAATGAGATAATAGAGGTAGG - Intergenic
946725854 2:222660414-222660436 TTTTAAGAAAGAAAAGATGAAGG + Intergenic
947034574 2:225837692-225837714 CTTTATGACAGACAAGAGGAAGG + Intergenic
947431222 2:230029800-230029822 GTTTTTCAGAGTATAGAGGAAGG + Intergenic
948925368 2:241092985-241093007 TTTTATGAAAGAGGAAAGGAAGG - Exonic
1169312302 20:4554488-4554510 TTTTATGAGAGAGTTGAGGCTGG - Intergenic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170579756 20:17689328-17689350 TTTTAAAACAGAATAGAGGCTGG + Intergenic
1171193217 20:23176370-23176392 TTTAATGAGAGAAATGAGTAGGG - Intergenic
1171242273 20:23581564-23581586 TTTTATGGGAAAAGAGGGGAGGG - Intergenic
1171897557 20:30823081-30823103 TCTTATGAGAGAAGAGAGAGGGG + Intergenic
1172814364 20:37674489-37674511 TTTGTTGAGTGAATAAAGGAAGG - Intergenic
1174329562 20:49807330-49807352 TATATTGAGAGAATAAAGGATGG - Intergenic
1175613000 20:60367346-60367368 TTTTATTAGTGAATATAGGATGG - Intergenic
1176264756 20:64203397-64203419 TTTTAGAAGAGACTAGAGGCAGG + Intronic
1177539106 21:22468557-22468579 TTGTATGAGAGGTTAGATGAAGG - Intergenic
1177713111 21:24805582-24805604 TTTTATAAGAAAATACAAGAAGG - Intergenic
1177864153 21:26492883-26492905 TTCTATGAGATCAGAGAGGACGG + Intronic
1177866746 21:26521215-26521237 TTTTAAAAGAGAATAAAGTAGGG + Intronic
1179525752 21:41974841-41974863 TTCGATGAGAGAGGAGAGGAGGG + Intergenic
1179530217 21:42013149-42013171 TGTTATGGGAGCACAGAGGAGGG - Intergenic
1181556635 22:23675205-23675227 TTTGATGAGAGAATGAATGATGG - Intergenic
1182059966 22:27390072-27390094 TTTTAAGAGAAAAGAAAGGAGGG + Intergenic
1182985647 22:34713768-34713790 TTTGGTGAGAGAATGAAGGAAGG - Intergenic
1183548251 22:38466921-38466943 TTTTATCACAGAAAAGAGGCTGG + Intergenic
949241270 3:1875217-1875239 TTTTAGGAAAGTATAGAGGAAGG + Intergenic
949381704 3:3454113-3454135 TTTTAGAAGAGAACTGAGGAAGG + Intergenic
952097712 3:29973693-29973715 TTCTAGGATAGAATAGAGAAAGG - Intronic
952632356 3:35484686-35484708 TTTTCTCATAGAATAGAGAAGGG - Intergenic
953123356 3:40067568-40067590 TTTTCTGTGAGCACAGAGGAGGG + Intronic
953852250 3:46473217-46473239 GATTATGGGAGAAGAGAGGAAGG - Intronic
954156323 3:48686659-48686681 CTTTCTGAGAGCATAGAGGAGGG + Intergenic
954273445 3:49527076-49527098 TTTTAACAGAAAATAGAGAAGGG - Intronic
955204356 3:56882055-56882077 TTTTATGAGAGAAAAGACACAGG + Intronic
957241582 3:77667268-77667290 TGTGATGAGAGAAGAGAGGGAGG - Intergenic
957587804 3:82155233-82155255 CTTTATAAGAGAAAAGAAGAAGG - Intergenic
957748350 3:84375410-84375432 TTTTATTAAAAAATAAAGGAGGG - Intergenic
958099999 3:88997402-88997424 TTATATGAAAGAACAGAGTAAGG - Intergenic
958919956 3:100093704-100093726 TTTCAGGAGAGAGTAGGGGATGG - Intronic
958977078 3:100680743-100680765 TACTATGAGAGAACGGAGGATGG - Intronic
959248842 3:103912825-103912847 TTTCATAAGAAAAAAGAGGATGG + Intergenic
959469992 3:106738579-106738601 TTTTAGGGGAGAAAAGTGGAAGG - Intergenic
960280295 3:115774084-115774106 TATTATGCGAGCATGGAGGAAGG + Intergenic
960638099 3:119803665-119803687 TTGTATTAGAGAATATGGGATGG - Intronic
962392209 3:134982290-134982312 TTTGATGAATGAATAAAGGAGGG + Intronic
962608687 3:137054687-137054709 TTTTTTGAGCCAATAGAGGCAGG - Intergenic
962897943 3:139732766-139732788 TTTTATGAAAGAATCCAGGGTGG - Intergenic
963748189 3:149147159-149147181 TTTTATGAAACAATGGAGGCTGG + Intronic
964015916 3:151946578-151946600 TTTTATTGGAGGATAGAAGAAGG + Intergenic
964532841 3:157686349-157686371 TTTGATGAGTGGAGAGAGGAAGG + Intergenic
964824698 3:160812235-160812257 ATTTAAGAAAGAAAAGAGGAAGG - Intronic
965011653 3:163100807-163100829 TCTTAGGAGAGAACAGAGGGAGG + Intergenic
965244774 3:166253575-166253597 TTTTATTAGAGAATATAACAAGG - Intergenic
965396141 3:168162340-168162362 ATTTATGAGTGCATAGAGGTAGG + Intergenic
966177932 3:177159562-177159584 TTTTAAGAAAGAAGAGAGAATGG - Intronic
966198377 3:177336176-177336198 TTGTATTAGAAATTAGAGGAAGG - Intergenic
966483099 3:180433572-180433594 TATTATGGGAGTATAGAGAACGG - Intergenic
967309381 3:188091598-188091620 CCTTAGGAGAGAATAGAGGCAGG - Intergenic
967427903 3:189348668-189348690 CTTTATGAGAGAATAAATGTAGG + Intergenic
967474782 3:189903750-189903772 TTTCCTGAGAGATTAGAAGAGGG - Intergenic
967629623 3:191730253-191730275 CTTTATGAAAGAATAGGTGAGGG - Intergenic
969092367 4:4704353-4704375 TTTAATGAGAGAAGGGTGGAAGG + Intergenic
969330183 4:6470383-6470405 ATTTATGAAAGAAAAGGGGACGG + Intronic
969829590 4:9783696-9783718 TCCTATGAGAGAAGAGAGTATGG + Exonic
969916394 4:10495756-10495778 TTTGATGAGAGAAGAGGAGAAGG + Intronic
970983636 4:22129959-22129981 TTTTATTAGAAAAAAGAAGAGGG - Intergenic
971369196 4:26002245-26002267 TTTTATGAGACTAGAGAGAAGGG - Intergenic
971667478 4:29508391-29508413 TTTTATGTGAGTATAATGGATGG - Intergenic
971962681 4:33508755-33508777 ATTTTTGTGAGAAAAGAGGATGG + Intergenic
972291987 4:37698019-37698041 TCTTTAAAGAGAATAGAGGAAGG - Intergenic
974273622 4:59686377-59686399 TTTTATTAGAAAATAGAATAAGG + Intergenic
974348526 4:60714562-60714584 TTTTATGATAGAATAAAAGAAGG - Intergenic
975738463 4:77404999-77405021 GTCTATGAGAGAAAAGAGTAGGG + Intronic
976318107 4:83681143-83681165 TTTTATGAGACAATATCAGAGGG - Intergenic
976323825 4:83748543-83748565 GCTTATGAAAGAATAGAGAAGGG - Intergenic
976542628 4:86295796-86295818 TAGTAAGAGAGAAAAGAGGATGG - Intronic
977534583 4:98242170-98242192 TTTAATGGGAAAACAGAGGAAGG - Intergenic
977873850 4:102125874-102125896 TTTTATGACAGAAAGGTGGAAGG - Intergenic
978045953 4:104127811-104127833 TTATATGAAAAAAAAGAGGAAGG + Intergenic
978747980 4:112215971-112215993 TTTTCTGATAGAATATAAGATGG - Intergenic
978861329 4:113452937-113452959 TGAGATGAGAGAAAAGAGGAAGG + Intronic
979118269 4:116856810-116856832 TTTTATTACAGAATATAAGATGG + Intergenic
979950281 4:126884257-126884279 TATAATGAGAGAAGAGAGGAGGG + Intergenic
980591669 4:134897578-134897600 TTTTATGAAAGAAAATTGGATGG + Intergenic
980603149 4:135052309-135052331 TTTTAAAAGATAACAGAGGAGGG - Intergenic
980908938 4:138976420-138976442 TGTTAAGAGAGAATATAGGAAGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982162387 4:152583265-152583287 TATTGTGAGAGAATAAATGAGGG - Intergenic
982957998 4:161794854-161794876 TATGATGAGAGATTAGAGAAAGG - Intronic
983160467 4:164407606-164407628 GTTCAGGAGAGAATAGAAGATGG - Intergenic
983184587 4:164687507-164687529 GTGTATGAGAAAATATAGGATGG - Intergenic
983317717 4:166153294-166153316 TTGTAGGGGAGAAGAGAGGATGG + Intergenic
983887400 4:172995792-172995814 TGTTATGAGACAAAAGAGCATGG - Intronic
984121649 4:175752515-175752537 CTTTTTTAGAGCATAGAGGAGGG - Intronic
984436372 4:179715395-179715417 TTTTAATACAGAAAAGAGGAAGG - Intergenic
984871181 4:184326614-184326636 TTTTTAGACAGAATAGGGGATGG - Intergenic
985865661 5:2512140-2512162 TTTAATAAGAAAATAGTGGAAGG - Intergenic
986046755 5:4045211-4045233 TTTTTTTAGACAATAAAGGAAGG + Intergenic
986129899 5:4919885-4919907 TTTTATGAGAAAATGGATGCTGG - Intergenic
988213156 5:28234958-28234980 TTTTATGAGAGATAAAATGAAGG + Intergenic
989077788 5:37583128-37583150 TTATTTAAGAGAATAGAGGCTGG + Intronic
989100049 5:37814860-37814882 TTGTAGGAGAGAATCGGGGAAGG - Intronic
989430563 5:41350217-41350239 TTCAATGAGAAAACAGAGGACGG - Intronic
989553452 5:42763036-42763058 TTTTATTAGAGAATGGTGTAAGG - Intronic
989974981 5:50573922-50573944 TTTTGTGATAGAATGGAGCATGG + Intergenic
990069813 5:51767483-51767505 TTTTATAAGGGTATACAGGAAGG - Intergenic
990211032 5:53481446-53481468 TTTTTTGCGAGAATGGGGGATGG - Intronic
991921180 5:71658408-71658430 TTTTACAAGAGCATAGAGTAGGG - Exonic
992706360 5:79398223-79398245 TTTTTTGAGAGAACAGAGAGGGG + Intronic
993020883 5:82589336-82589358 AAGTATGAGAGAATAGAGAAGGG - Intergenic
993874769 5:93293407-93293429 TTTTATAAGCAAATAGAGGCTGG - Intergenic
994286681 5:97977527-97977549 TTTTATGAAAGAACAGATAAGGG - Intergenic
995063418 5:107835691-107835713 TTTTATGAGAGGCTGGAGGGTGG + Intergenic
996498660 5:124191252-124191274 ATCTATGACAGAATAGGGGAAGG - Intergenic
996604227 5:125302428-125302450 TTTTACGTGAGAAAATAGGAAGG - Intergenic
997420943 5:133766229-133766251 TTTTAAAACAGAAAAGAGGAAGG + Intergenic
997475932 5:134142472-134142494 TTTTCTGAGCCAACAGAGGAGGG + Intronic
997591794 5:135078118-135078140 TTATTTTAGAGAGTAGAGGATGG - Intronic
997816473 5:137023762-137023784 TTCTGTGAGAGCATAAAGGAAGG - Intronic
998236222 5:140401057-140401079 ATTTGGGAGGGAATAGAGGACGG - Intergenic
998316987 5:141191796-141191818 TTTTATGAGAGAATAGAGGAGGG + Intronic
998622053 5:143805593-143805615 TTTTATGAGTGAAGAAATGAAGG + Intergenic
999012946 5:148062687-148062709 TTTCATGAGAGAAAAAAGAAAGG + Intronic
999233196 5:150074672-150074694 TTTTTAGACAGAATAGAGTAAGG - Intronic
999506264 5:152200485-152200507 TTTGTTGAGAGAAAAGATGATGG - Intergenic
1000385434 5:160670719-160670741 ACTAATGAAAGAATAGAGGAAGG + Intronic
1000691619 5:164328108-164328130 TTTTATGAGAGCCTAGACCAGGG + Intergenic
1000791312 5:165610974-165610996 TTATAGGAGAGAAGAGTGGATGG - Intergenic
1002814425 6:666176-666198 TTTCATGTGAGAATGGAGAAAGG - Intronic
1003069884 6:2937769-2937791 TTTTAGGAGAGAATACAGACAGG + Intergenic
1003109273 6:3239933-3239955 ATTTAACAGAGAAAAGAGGAAGG - Intronic
1003890968 6:10563277-10563299 TTTTATGAGAGAAAAGGGTACGG - Intronic
1004565995 6:16798265-16798287 TTTCATGACAGAAGAGAGAAGGG - Intergenic
1004704343 6:18109869-18109891 TTCTATCAGAAAATAAAGGAGGG + Intergenic
1005273088 6:24187155-24187177 TTTTTTAAGGAAATAGAGGAGGG - Intronic
1006428253 6:33979445-33979467 TTGAATGAGAAAATAGAGAAAGG - Intergenic
1007025005 6:38562578-38562600 ATTTATATGAGAATAGAGAATGG - Intronic
1007141103 6:39575581-39575603 TTTTTCGTGAGAATAGGGGATGG + Intronic
1007366250 6:41396069-41396091 TAGTATGAGAGAATCGAGAAGGG - Intergenic
1007843239 6:44733762-44733784 TTTTCTGGGAGGGTAGAGGATGG + Intergenic
1009508102 6:64511686-64511708 TTTTCTGAGAGAACAAAGAAAGG + Intronic
1009573669 6:65423767-65423789 TATTATGAAAGAATAGAAGCGGG - Intronic
1010139923 6:72602323-72602345 TTCTATGTGAGAAAAGTGGAGGG - Intergenic
1010699190 6:79021687-79021709 ATTCATGAGATAGTAGAGGATGG + Intronic
1010704977 6:79097156-79097178 TTTTATTGGAGATTAGAGTAAGG - Intergenic
1011398439 6:86935178-86935200 TGTTATGGGAGCACAGAGGAGGG - Intergenic
1011540608 6:88423497-88423519 TTGTATGAAAGAATTGCGGAAGG + Intergenic
1011641554 6:89420593-89420615 TTTTATTAGAGACTAGAGATGGG - Intergenic
1012216164 6:96587222-96587244 TTTGATGAGAGAAATGAGCAGGG - Intronic
1012246805 6:96935478-96935500 TTTTGTGAAGGAAAAGAGGAGGG + Intronic
1012273085 6:97239097-97239119 TTTTAGGAGAGAATAGAGTTGGG + Intronic
1012588837 6:100954374-100954396 TCTTATGAGAGTATAGAGTTTGG - Intergenic
1013317587 6:108957176-108957198 TTTCAGGAGAGAATAGAGAAGGG - Intronic
1014237808 6:118979541-118979563 TATTATGCTAGAATATAGGAAGG + Intronic
1014429625 6:121352464-121352486 TTTTATCAGAGAATTAAGGTAGG + Intergenic
1014823277 6:126017706-126017728 TATTATGAGAGCACAGAGGATGG - Intronic
1015389184 6:132662098-132662120 TGTTATGAGAGAGCAGAAGAAGG + Intergenic
1016386163 6:143532858-143532880 CTTTAGGAGAAAATAGAAGATGG + Intergenic
1016704936 6:147095786-147095808 ATTTATGAGAAAATAAAAGAGGG + Intergenic
1017249040 6:152260343-152260365 TTTTATCAGGGATTTGAGGAAGG + Intronic
1018179881 6:161213749-161213771 TATGAAGAGAAAATAGAGGAAGG - Intronic
1019784154 7:2963471-2963493 TATAATGAGAAAATGGAGGAAGG + Intronic
1021132850 7:16932191-16932213 TTTTAGGAAAAAATAAAGGATGG - Intergenic
1022796939 7:33739392-33739414 TTTGATGTGAAAATAGAGGGAGG + Intergenic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1023025645 7:36047608-36047630 TGATTTGAGAGAATAAAGGAAGG + Intergenic
1024551449 7:50565916-50565938 TTTTATGAGAGCACAAAGCAGGG + Intergenic
1027754641 7:82196827-82196849 TTATATATGTGAATAGAGGATGG + Intronic
1027842678 7:83333618-83333640 TATAATCAGAGAATAGATGAGGG + Intergenic
1028179987 7:87708047-87708069 TTTTAAAAAAGAATAGAGGCTGG + Intronic
1028255359 7:88589402-88589424 TTTTAAGGGAGCATAGAGGAAGG - Intergenic
1028386101 7:90254805-90254827 TCTGATGGTAGAATAGAGGATGG + Intronic
1028394721 7:90355816-90355838 TTTAATGAAAGAATGGAGGCTGG - Intronic
1028538126 7:91912075-91912097 GTTTAAGAGAGAATGGGGGATGG + Intergenic
1028739585 7:94258411-94258433 TTTAGTGAGAGAATTAAGGAAGG + Intergenic
1029298721 7:99561771-99561793 TTTTACTAGAGTATTGAGGAGGG + Intronic
1030145946 7:106355856-106355878 TTTTTTGAGTGAATAAATGAGGG + Intergenic
1030377439 7:108770077-108770099 TTTTTTGATGGAATAGATGATGG + Intergenic
1030379127 7:108791676-108791698 CTTTAGCAGAGCATAGAGGAAGG - Intergenic
1031359297 7:120828144-120828166 TTTAATGATAGAAGAGAGAATGG - Intronic
1031454063 7:121957594-121957616 TTTTCTGAGAAAATAGGGAAAGG + Intronic
1031885328 7:127240340-127240362 TTTAATGAGAAAATGCAGGAAGG - Intronic
1032060640 7:128722142-128722164 TTCTTTCAGAAAATAGAGGAGGG - Intronic
1032955119 7:136961726-136961748 CTTTATTAGAGAAAAGAGGTAGG + Intronic
1033012740 7:137639821-137639843 TTTTTTAAAAGAAAAGAGGATGG - Intronic
1036480507 8:9134937-9134959 TTTTATGGGTAAAGAGAGGAAGG - Intergenic
1037007325 8:13798213-13798235 TCTTCTGAGAGAGTGGAGGAAGG - Intergenic
1038146938 8:24905780-24905802 TGTCATGAGAGCACAGAGGATGG - Intergenic
1038603662 8:28975751-28975773 TTTTGTAAGAGAAGAGAGGAAGG + Intronic
1038913872 8:31997989-31998011 ATTTAAGAGGCAATAGAGGATGG - Intronic
1039110236 8:34034042-34034064 TTTTATGAAGGGAGAGAGGATGG + Intergenic
1039469048 8:37802423-37802445 TTTTGTGAGAGAAGAGGGGGAGG + Intronic
1039628069 8:39076625-39076647 TGTTATGAAAGGATATAGGAAGG + Intronic
1040879347 8:52188791-52188813 AATTATGAGAGATTAGATGATGG + Intronic
1040909486 8:52503310-52503332 TTGTATGAGGGATTACAGGAAGG + Intergenic
1041419827 8:57654056-57654078 TTTTCTGAGACGATGGAGGAGGG - Intergenic
1042181737 8:66095586-66095608 TTTAATGTAAGAACAGAGGAAGG - Intronic
1042262930 8:66878213-66878235 TGTTCAGAGAGAAGAGAGGAGGG - Intronic
1042368666 8:67965705-67965727 TTGTTTGACAGGATAGAGGAGGG + Intronic
1042403735 8:68379198-68379220 TTTGAAGAGAGAAAAGATGATGG + Intronic
1042734342 8:71970835-71970857 ATATGTGAGAGAAGAGAGGAAGG + Intronic
1043328484 8:79083149-79083171 TTTCATTAGATGATAGAGGAGGG + Intergenic
1043560828 8:81491349-81491371 TTTTATGAGAAAATGGACCAAGG + Intergenic
1044071495 8:87766153-87766175 TTTTAATAGAGAATAGTTGAAGG - Intergenic
1044534730 8:93345682-93345704 GTTTATGGGAGCATAGAGGAGGG - Intergenic
1044710279 8:95050697-95050719 TTTGATGAGAGTTTAGAGGTTGG + Intronic
1046773561 8:118140094-118140116 TTTTTTGAAAGAATAAGGGAGGG - Intergenic
1047006515 8:120625544-120625566 TCATTTGAGAGAATAGATGATGG + Intronic
1047819139 8:128499429-128499451 TGTTATGAGAATACAGAGGAGGG - Intergenic
1048238999 8:132721856-132721878 CTTTGTGAGAGGATAGAGGTGGG + Intronic
1049358631 8:142201250-142201272 TTTTATGGGAAAATAGAGCTGGG - Intergenic
1050779055 9:9307353-9307375 TTTTAAAACAGAATAAAGGAAGG - Intronic
1050936410 9:11401326-11401348 TTTGGTGAGAGTATAGGGGAGGG - Intergenic
1051332597 9:16038793-16038815 TTTTATAAGAGAAAATATGAGGG + Intronic
1051525087 9:18033978-18034000 TACTCTGAGAGAAGAGAGGAGGG - Intergenic
1051556889 9:18393725-18393747 TTTTAAGAGAGAACATAGAAAGG + Intergenic
1051701236 9:19826404-19826426 ATTTGTGAGAGAATAGAGAAAGG + Intergenic
1051945482 9:22564728-22564750 TATTTTGAGTGAATAAAGGATGG + Intergenic
1052950971 9:34211132-34211154 TATAATGAGAGAATAAATGAAGG - Intronic
1053210803 9:36226000-36226022 AGTTATGAGGGAATAAAGGAAGG - Intronic
1053284617 9:36842207-36842229 TCAGAAGAGAGAATAGAGGAAGG - Intronic
1053624660 9:39856347-39856369 TTTTAGAAGAAAATATAGGAGGG - Intergenic
1053750120 9:41244893-41244915 TCTTATGAGAGAAGAGAGAGAGG + Intergenic
1053880210 9:42586881-42586903 TTTTAGAAGAAAATATAGGAGGG + Intergenic
1054219236 9:62394351-62394373 TTTTAGAAGAAAATATAGGAGGG + Intergenic
1054231478 9:62514822-62514844 TTTTAGAAGAAAATATAGGAGGG - Intergenic
1054255619 9:62809232-62809254 TCTTATGAGAGAAGAGAGAGAGG + Intergenic
1054335691 9:63806375-63806397 TCTTATGAGAGAAGAGAGAGAGG - Intergenic
1054591419 9:67015820-67015842 TTTTAGAAGAAAATATAGGAGGG + Intergenic
1054699255 9:68396169-68396191 TTTTATGAGGTAATTGAGGTAGG + Intronic
1054736098 9:68751494-68751516 TGAGATGAGAGAATAGAGGCAGG + Intronic
1054769877 9:69073704-69073726 TTAAATGAGAGAATAGAGTATGG + Exonic
1055070198 9:72158134-72158156 TTTTATGGAAGAACAGAGGAAGG - Intronic
1055970728 9:81909997-81910019 TTTTATAAGAGATTATATGAAGG - Intergenic
1056054472 9:82806638-82806660 TATTATGAGAACAAAGAGGAAGG - Intergenic
1056095336 9:83247633-83247655 TATTATGATATAATAGATGAAGG + Exonic
1056160765 9:83890171-83890193 TTTTAGGAGAGAATACATGACGG - Intronic
1056359372 9:85839151-85839173 TTTTAGGAGAGAATACATGACGG + Intergenic
1056808028 9:89743778-89743800 TTTTATCAGAGACCAGAAGAAGG - Intergenic
1057709567 9:97427133-97427155 TTTTATTAAAGGAAAGAGGAAGG - Intronic
1058606163 9:106725887-106725909 TTTTTTAAGAGAATGAAGGAGGG + Intergenic
1058934744 9:109758799-109758821 TTGTAGGAAAGAATAGAGGAAGG - Intronic
1059360053 9:113735140-113735162 TATTATGAGAGAAAAGGGGAAGG + Intergenic
1059912339 9:119059052-119059074 TTTTATGATAGAAAAGAGAATGG - Intergenic
1060098784 9:120818936-120818958 TTTTATCTAAGAACAGAGGAAGG + Intronic
1060965486 9:127710327-127710349 TTTCATGAGAGTATCAAGGAAGG + Intronic
1061445953 9:130637777-130637799 ATTTCTGAGATAATAGAGAAAGG - Exonic
1186130133 X:6457142-6457164 TTTTATGATAAATTAGAAGAAGG - Intergenic
1186263155 X:7802814-7802836 TTTCATGAGGAAATAGGGGATGG - Intergenic
1186798184 X:13066785-13066807 TACTATGAGAGCCTAGAGGAGGG - Intergenic
1186909554 X:14147633-14147655 TGTTATGAGAATATAGAGGATGG - Intergenic
1187047249 X:15659428-15659450 GTTTATGAGGGAAAAGAGAAAGG - Intronic
1187054178 X:15726031-15726053 TTTTAAAAGAGAAAAGAGGGTGG - Intronic
1187076571 X:15941310-15941332 TGTTTTGAGAGAATATAGCAGGG + Intergenic
1187584257 X:20642561-20642583 TTTGATGATAAAATAGAGCATGG - Intergenic
1187956035 X:24519894-24519916 TATTATAAGAAAATAGAGGCTGG + Intronic
1188018190 X:25127925-25127947 TTGAAGGAGAGACTAGAGGAAGG + Intergenic
1188214873 X:27463569-27463591 TTTTAAGAGACAGTAGGGGATGG - Intergenic
1188377653 X:29452464-29452486 TTTTATGAGACAATTTAGGGAGG + Intronic
1188592794 X:31859706-31859728 CTTTATGAGACAATGGAGAAAGG + Intronic
1189506881 X:41620195-41620217 TTTTAAAAGGGAATAGTGGAAGG + Intronic
1189696367 X:43667426-43667448 TTTGATGGGTGAATAGATGAAGG + Intronic
1190030329 X:46966172-46966194 TTTTGTGATGGCATAGAGGAAGG + Intronic
1190834910 X:54091672-54091694 TGCTATGAGAGCATAGAAGAGGG + Intronic
1191102520 X:56747296-56747318 TTCTATAAGAGAATACAAGAAGG + Intergenic
1192306724 X:69968197-69968219 TGTCATGGGAGCATAGAGGAGGG + Intronic
1193824161 X:86202219-86202241 TTATATGGGAGGATGGAGGAGGG + Intronic
1194928677 X:99861222-99861244 TTTTAAGACAAATTAGAGGAGGG + Intergenic
1194957438 X:100197626-100197648 TTGTATAAGACAATAGAAGAAGG + Intergenic
1196143537 X:112291935-112291957 TCTTAGGAGAGAAGGGAGGAGGG - Intergenic
1196399810 X:115302428-115302450 TTTTAGGAGGCAATACAGGAGGG + Intronic
1196535774 X:116841684-116841706 TTTCAGGAAAGAAAAGAGGATGG + Intergenic
1196675118 X:118412133-118412155 CTATATGAGAGAAGAAAGGAAGG + Intronic
1197172952 X:123454727-123454749 TATTCTGGGAGAATGGAGGAAGG - Intronic
1197255523 X:124258770-124258792 CTTTATGAGTGAATTGAGAAAGG - Intronic
1197323871 X:125067847-125067869 TTTTTTGAGAGAATAAAAGTTGG + Intergenic
1198103355 X:133440592-133440614 TTTTATGTGAGCAGGGAGGAAGG - Intergenic
1198478208 X:137016349-137016371 TTTTGTGAAAGCACAGAGGAGGG + Intergenic
1198597835 X:138256357-138256379 TTTTATGAAAGAGCAGAAGAGGG + Intergenic
1198775719 X:140177004-140177026 TGTCATAAGAGCATAGAGGAGGG + Intergenic
1201652843 Y:16310010-16310032 TTTCATGGTAGAAGAGAGGATGG - Intergenic
1202575661 Y:26321972-26321994 TGCTATGAGAGTGTAGAGGAGGG - Intergenic