ID: 998321267

View in Genome Browser
Species Human (GRCh38)
Location 5:141234761-141234783
Sequence CTATAAACCTTATTTGCGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998321266_998321267 -4 Left 998321266 5:141234742-141234764 CCAGAGTCATCTTTGACGACTAT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 998321267 5:141234761-141234783 CTATAAACCTTATTTGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69
998321265_998321267 14 Left 998321265 5:141234724-141234746 CCTGGCTGCAAGGGGGGGCCAGA 0: 1
1: 0
2: 3
3: 23
4: 203
Right 998321267 5:141234761-141234783 CTATAAACCTTATTTGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998321267 Original CRISPR CTATAAACCTTATTTGCGAT TGG Intergenic
909626812 1:77726244-77726266 TTATAAACATTAGTTGGGATTGG - Intronic
917229544 1:172821461-172821483 CTATAAACCTTAGTTGTTACAGG - Intergenic
919954989 1:202404794-202404816 GTATAAACATTATTTGGGCTGGG - Intronic
921639600 1:217536548-217536570 GTATTCACCTTAATTGCGATGGG - Intronic
923872141 1:238007089-238007111 CTATAACCATTATTTTAGATAGG + Intergenic
1066254203 10:33662818-33662840 CTATAACCCTTCCTTGCAATCGG - Intergenic
1070915698 10:80153218-80153240 CTGTACTCCTTATTTGCTATAGG - Exonic
1072066446 10:91876080-91876102 CTCTAAGCCTTATTTGTGAGTGG + Intergenic
1074553409 10:114466341-114466363 ATATAAACCTTAATAGAGATAGG + Intronic
1079788749 11:24709637-24709659 ATATAAACTTTATTTGCTAATGG + Intronic
1090094999 11:123733975-123733997 CTAGAAACCTTATTTTGGTTTGG + Intronic
1095775985 12:46010747-46010769 CTTTAAAACTTACTTGGGATTGG - Intergenic
1098569215 12:71969677-71969699 CTATAAACCTTATTTTAGTTTGG + Intronic
1098805756 12:75018558-75018580 ATAAAAACCTTATTTATGATTGG + Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1100097907 12:91066376-91066398 CTAGAAATCTAATTTGCAATTGG + Intergenic
1115930708 14:38489924-38489946 CTAAAAACCTTTTTTGGGTTTGG - Intergenic
1116601140 14:46924946-46924968 CTATTAACCTTATCTCCCATGGG - Intronic
1118899784 14:69976982-69977004 CTAGAAACCTTAATTGGGGTTGG + Intronic
1130857622 15:87855069-87855091 CCATAAACCATATTTATGATCGG + Intergenic
1139112624 16:63909636-63909658 CTATAATCCTTATATGAAATTGG - Intergenic
1139119227 16:63995396-63995418 CTATAAACTTTAAGTTCGATGGG - Intergenic
1142735532 17:1896467-1896489 CTATAAACATTAAATGAGATAGG + Intronic
1146247187 17:31297426-31297448 CTATATATCTGATTTGCTATAGG + Intronic
1151327313 17:73387327-73387349 CTATAAGCCTTATTTCCTCTGGG + Intronic
1155079905 18:22398564-22398586 ATAAAAACCTGATTTGCAATCGG + Intergenic
1156585868 18:38430260-38430282 CCATAAACCTTATTTGCTGTGGG - Intergenic
1159182720 18:64929520-64929542 CTATGAACATTATATGAGATGGG + Intergenic
1159572550 18:70134504-70134526 CAATAAACCTTCTTTGCCATCGG - Exonic
927160244 2:20251164-20251186 CTATAAACCTGTTGTGCTATGGG + Exonic
931533077 2:63239164-63239186 CTATAATACTTTTTTGCTATAGG - Intronic
934345908 2:92343495-92343517 CTCAGAAACTTATTTGCGATGGG + Intergenic
934351352 2:92430164-92430186 CTCAGAAACTTATTTGCGATGGG + Intergenic
934421790 2:93560810-93560832 CTCAGAAACTTATTTGCGATGGG + Intergenic
934441806 2:93883118-93883140 CTCAGAAACTTATTTGCGATGGG + Intergenic
942875278 2:180788396-180788418 CTATATACCTCATTTTCCATAGG + Intergenic
1169102380 20:2962216-2962238 CCATAAACATTATTTATGATGGG + Intronic
1171761405 20:29200747-29200769 CTGTGAAACTTATTTGCGATGGG + Intergenic
1177185499 21:17789450-17789472 CTTTAAACCTTTTTTGGGAGAGG + Exonic
1183844798 22:40533524-40533546 CTACAAATCTTATTTGCCACAGG - Intronic
954839488 3:53497822-53497844 CTGTATACCTTGTTTGCAATAGG - Intronic
957527768 3:81399182-81399204 CTATAAAACTCATTTGTAATTGG + Intergenic
958116516 3:89226171-89226193 CTCTATCCCTTATTTGCTATGGG + Intronic
958666401 3:97143742-97143764 CTACAAAACTTATTGGTGATGGG - Intronic
966271771 3:178115993-178116015 CTAGAAAGCTGATTTGCTATAGG + Intergenic
970306821 4:14741424-14741446 CTATAACCTTATTTTGCGATAGG - Intergenic
975315992 4:72953808-72953830 CTGAAAACTTTATTTGCTATGGG - Intergenic
975337837 4:73201312-73201334 CTATAAACTTTTTTTACTATAGG + Intronic
983814563 4:172107437-172107459 CTATAAAACTAATTGGCTATTGG + Intronic
986418411 5:7551224-7551246 CTAAAAATCTTATTTGGGGTTGG + Intronic
990291064 5:54352410-54352432 CTATAAACAATAATTGCTATTGG + Intergenic
998321267 5:141234761-141234783 CTATAAACCTTATTTGCGATTGG + Intergenic
1003562172 6:7189910-7189932 CTATAAACTCTATTTTCCATAGG - Intronic
1009253776 6:61348415-61348437 CTGAAAACCTTCTTTGTGATGGG + Intergenic
1009258462 6:61450236-61450258 CTGAAAACCTTCTTTGTGATGGG + Intergenic
1013448665 6:110257178-110257200 CTAGAAAACATATTTGAGATGGG - Intronic
1013576323 6:111486356-111486378 CTATAAACCTTATAAGGGAAGGG - Intergenic
1018362198 6:163082678-163082700 CTATAAAGCATATTTGCACTCGG - Intronic
1032924835 7:136591422-136591444 TTATAAACGTTATATGCAATTGG + Intergenic
1033616415 7:143020228-143020250 GTATATACCTTATTTGTGAATGG + Intergenic
1040753121 8:50736271-50736293 ATATAAACCTTAATTGCAAATGG + Intronic
1043806224 8:84675095-84675117 CGATAAATCTTATTTGTTATGGG - Intronic
1046213102 8:111104797-111104819 CTATGAACCTGACTTGTGATTGG + Intergenic
1050745025 9:8866069-8866091 CTGTAAACATTATTTCCTATAGG + Intronic
1051543620 9:18249519-18249541 CTATTTACCATATTTGCGTTAGG + Intergenic
1051923985 9:22300581-22300603 ATATCAACCTTATTTTGGATTGG + Intergenic
1053971653 9:43743271-43743293 CTCAGAAACTTATTTGCGATGGG + Intergenic
1053979693 9:43881984-43882006 CTCAGAAACTTATTTGCGATGGG + Intergenic
1060458296 9:123822291-123822313 CTATAAACTTTATATGAGACAGG + Intronic
1186291770 X:8108143-8108165 CTATAAACCTTAATTAAGAAGGG + Intergenic
1189227657 X:39426951-39426973 TTATAAACCTTATGTTCTATGGG + Intergenic
1190575267 X:51830517-51830539 CTATAAACTTTAATTGGTATTGG - Intronic
1195613733 X:106896426-106896448 CTAACAACCTTATTTGGGATGGG + Intronic
1195616830 X:106919362-106919384 CTAGAAAGCTTTTTTGCGTTGGG + Intronic
1197037515 X:121893252-121893274 CTATAAACCTTATATCAGAATGG - Intergenic