ID: 998321339

View in Genome Browser
Species Human (GRCh38)
Location 5:141235396-141235418
Sequence CCCACGTCTCCAGAGATGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998321339 Original CRISPR CCCACGTCTCCAGAGATGTA CGG Intergenic
900102762 1:969124-969146 CCCACGTCTGCAGTATTGTATGG - Intronic
903947359 1:26972174-26972196 CCCAAGTCTACAGGGATGAAGGG + Intergenic
905359586 1:37410290-37410312 CCCACATCGCCAGAGAAGAAAGG - Intergenic
906137339 1:43508615-43508637 CCCACATCCCCACAGATGTATGG + Intergenic
916420832 1:164636211-164636233 CTCAGGTCTACAGAGATGGAAGG + Intronic
918912551 1:190592316-190592338 GCCAAGTCTCCACAGAGGTAAGG - Intergenic
922696730 1:227734807-227734829 ACCACGTCTCCTGAAATGAAAGG + Exonic
923047663 1:230367370-230367392 ACCACGTCACCAGCCATGTAGGG + Intronic
924817108 1:247452114-247452136 CCAGCGTCTCCACAGAGGTAAGG - Intergenic
1062905995 10:1180137-1180159 GCCACCTCTGCAGAGATGGAAGG - Exonic
1065841250 10:29703345-29703367 CCCACTGCTCCAGAGATGTCAGG + Intronic
1068275012 10:54783596-54783618 CCCAAGTCTTCAGAGAGATATGG + Intronic
1068670580 10:59718522-59718544 TCCAAGTCTACAGAGAGGTATGG + Intronic
1077095627 11:797887-797909 CGCACGTGTCCACAGATGTCCGG + Exonic
1077451740 11:2652480-2652502 CCCACCTCTCCAGAGGTTTCTGG + Intronic
1082076170 11:47977968-47977990 CCCAGGTCTCCACAGATTCATGG - Intergenic
1085400442 11:76232686-76232708 CCCAAGCCTCCACAGATGCAGGG - Intergenic
1089892606 11:121896499-121896521 CCCAAGTCTCCAGACAGGAATGG - Intergenic
1090137103 11:124209981-124210003 CCCAAGTCTGCAGAGATGCCTGG + Intergenic
1090288375 11:125519912-125519934 CACATGACTCCTGAGATGTAAGG - Intergenic
1091213849 11:133887438-133887460 GCCACGTGTCCAGAGGTGGAAGG - Intergenic
1097044577 12:56178016-56178038 TCCAAGACTCCAGAGATGTAAGG - Exonic
1099785022 12:87251126-87251148 CCCAAGTTTCCAGACATGAAGGG + Intergenic
1110588257 13:77221289-77221311 CCCAAGTCTGAAGAGATATAGGG - Intronic
1114830450 14:26135159-26135181 TCCAGGTCCCTAGAGATGTAGGG - Intergenic
1119719894 14:76883596-76883618 CCCACCTCTCCACAGCTGGAAGG + Intergenic
1123719324 15:23048454-23048476 CCCACCTGGCCAGAGATGTTGGG + Intergenic
1128248479 15:66148965-66148987 CCTCAGTCTCCAGAGCTGTAAGG + Intronic
1133382962 16:5346435-5346457 ACCACGTCTCAAGGGATGCATGG + Intergenic
1146798940 17:35803541-35803563 CCCAAGACTCAAGAGATGGAGGG + Intronic
1146828127 17:36041653-36041675 CCCAAGACTCAAGAGATGGAGGG - Intergenic
1151361492 17:73591961-73591983 CCCACGTCCCCAGAGAGGCTGGG - Intronic
1151577556 17:74960304-74960326 CCCACGTGGCCAGAGAGGTGTGG - Intronic
1163476881 19:17531829-17531851 CTCATGGCTCCAGAGATGTCTGG - Intronic
1164617347 19:29674983-29675005 CCCAGGTCTCCAGACATCTAGGG + Exonic
1165646270 19:37440808-37440830 TTCACTTCTCCAGAAATGTAGGG - Intronic
925717053 2:6794004-6794026 CTCACGTCTTCTGAGATCTATGG - Intergenic
932502342 2:72194413-72194435 CCCAGGTCTCCAAAGTTGTCTGG - Intronic
942547980 2:177084328-177084350 CCCACTTCTGCAGAGAGGGAAGG + Intergenic
948422590 2:237869655-237869677 CCCACGTGTCCATGGATGAATGG - Intronic
1170389087 20:15852468-15852490 CCCATGTTCCCAGAGATGTTTGG - Intronic
1172842422 20:37909898-37909920 CCCACTGCTCCAGAGAAGTGAGG + Intronic
1176008203 20:62877489-62877511 CCATCGTCTCCAGAGCTGGATGG + Intergenic
1177776761 21:25576605-25576627 CCCACTTCCCCAGAAATTTACGG + Intergenic
1178605620 21:34034206-34034228 CCCACGTATCAAGAGGTGCATGG - Intergenic
1180978830 22:19869084-19869106 AGCACCTTTCCAGAGATGTAAGG + Intergenic
1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG + Intergenic
1185363791 22:50425390-50425412 CCCAAGTCTCCACTGATGGATGG - Intronic
950612428 3:14134877-14134899 CCCAAGTATCCAGAGGTGTGCGG + Exonic
951111876 3:18813281-18813303 CCTAAGGCTCCAGACATGTAGGG + Intergenic
953844824 3:46418883-46418905 CCCAAGTCTCCAGCCATGTCTGG + Intergenic
954929619 3:54269703-54269725 ACCAGGTGTCCAGAGATGAATGG + Intronic
962984006 3:140518057-140518079 CGCAGGTCACCAGAGAAGTAGGG + Intronic
965921969 3:173927913-173927935 ACCAGGTCTTCAGAGAAGTAAGG - Intronic
970585472 4:17510819-17510841 CCCAGGTCTTCAGAGATGCATGG - Intronic
971587984 4:28430469-28430491 CCAAAGTATCCAGAGATATAAGG - Intergenic
977296928 4:95220676-95220698 CCCACCTCTCCATTGATTTAGGG - Intronic
985257109 4:188081278-188081300 CCTAGGTCTACAGTGATGTAGGG - Intergenic
985274546 4:188225096-188225118 CTCACTTTTCCTGAGATGTAAGG - Intergenic
991147064 5:63319229-63319251 CCCACATCACCAGTGATGTGAGG + Intergenic
997841575 5:137245673-137245695 CTCAAGTCTCAAGGGATGTACGG + Intronic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999724296 5:154422180-154422202 CCCATGTCTACAAAGCTGTAAGG - Intergenic
1002551881 5:180000430-180000452 CCCAAGTCTACGGAGATATATGG - Intronic
1012798719 6:103797479-103797501 CCCTAGTCTCCAGAGGTGAAAGG - Intergenic
1018655229 6:166027683-166027705 CCCACACCTCCTGCGATGTAAGG + Intergenic
1028834362 7:95357971-95357993 CCCACGTGCCCAGAGGGGTATGG - Intergenic
1029930263 7:104363462-104363484 CGCACGTCATCAGAGAAGTAAGG - Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1037269608 8:17112120-17112142 CCCACGTGTCCAGGGAGGGAGGG - Intronic
1037684226 8:21124793-21124815 ACCATGTCTCCAGAGCTGGAGGG + Intergenic
1039524608 8:38203092-38203114 ACAACTTCTCCAGATATGTAGGG - Intronic
1043305650 8:78791059-78791081 ATCACTTCACCAGAGATGTATGG - Intronic
1045734004 8:105274262-105274284 CCCACCTCTTCAGAGATCTGAGG - Intronic
1048194663 8:132322467-132322489 CCCACACCTCCTGAGCTGTAAGG + Intronic
1050207229 9:3210008-3210030 CCCACGTCCCCAGTCATGCATGG + Intergenic
1055843913 9:80537771-80537793 CCCAAGTCTCCACAATTGTAAGG + Intergenic
1195718595 X:107843384-107843406 CCCTCATCTCCAGGGATGGATGG + Intronic
1196323204 X:114368713-114368735 CCCCAGCCTCCAGAGATGTGAGG - Intergenic
1197699343 X:129586651-129586673 CCCAAGTCACCAGTGCTGTATGG + Intronic
1198200777 X:134416491-134416513 CCCACCCCTCCAGAGATAAAAGG + Intronic
1200860885 Y:7991185-7991207 GCCACATCTACACAGATGTAAGG + Intergenic