ID: 998322355

View in Genome Browser
Species Human (GRCh38)
Location 5:141244628-141244650
Sequence CCACCTCAGCAACTGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322355_998322363 -3 Left 998322355 5:141244628-141244650 CCCAGCTACAGTTGCTGAGGTGG No data
Right 998322363 5:141244648-141244670 TGGGGGGATTGCTTGAGCCTGGG 0: 36
1: 2583
2: 14083
3: 37110
4: 73057
998322355_998322364 6 Left 998322355 5:141244628-141244650 CCCAGCTACAGTTGCTGAGGTGG No data
Right 998322364 5:141244657-141244679 TGCTTGAGCCTGGGTAGTCAAGG No data
998322355_998322362 -4 Left 998322355 5:141244628-141244650 CCCAGCTACAGTTGCTGAGGTGG No data
Right 998322362 5:141244647-141244669 GTGGGGGGATTGCTTGAGCCTGG 0: 37
1: 2320
2: 7140
3: 14621
4: 24962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322355 Original CRISPR CCACCTCAGCAACTGTAGCT GGG (reversed) Intergenic
No off target data available for this crispr