ID: 998322761

View in Genome Browser
Species Human (GRCh38)
Location 5:141247583-141247605
Sequence GCCTCTGGGAGCGGCAGGTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 3, 2: 12, 3: 17, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322761_998322769 -3 Left 998322761 5:141247583-141247605 CCCTACCTGCCGCTCCCAGAGGC 0: 1
1: 3
2: 12
3: 17
4: 214
Right 998322769 5:141247603-141247625 GGCGGCCCCGGCCCAAGCCCAGG 0: 2
1: 7
2: 10
3: 67
4: 658
998322761_998322778 21 Left 998322761 5:141247583-141247605 CCCTACCTGCCGCTCCCAGAGGC 0: 1
1: 3
2: 12
3: 17
4: 214
Right 998322778 5:141247627-141247649 CGACTCGCTTACCGTCTACCTGG 0: 1
1: 1
2: 15
3: 1
4: 12
998322761_998322780 27 Left 998322761 5:141247583-141247605 CCCTACCTGCCGCTCCCAGAGGC 0: 1
1: 3
2: 12
3: 17
4: 214
Right 998322780 5:141247633-141247655 GCTTACCGTCTACCTGGTGGTGG 0: 1
1: 8
2: 9
3: 4
4: 65
998322761_998322779 24 Left 998322761 5:141247583-141247605 CCCTACCTGCCGCTCCCAGAGGC 0: 1
1: 3
2: 12
3: 17
4: 214
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322761 Original CRISPR GCCTCTGGGAGCGGCAGGTA GGG (reversed) Exonic