ID: 998322762

View in Genome Browser
Species Human (GRCh38)
Location 5:141247584-141247606
Sequence CGCCTCTGGGAGCGGCAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 3, 2: 11, 3: 12, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322762_998322780 26 Left 998322762 5:141247584-141247606 CCTACCTGCCGCTCCCAGAGGCG 0: 1
1: 3
2: 11
3: 12
4: 187
Right 998322780 5:141247633-141247655 GCTTACCGTCTACCTGGTGGTGG 0: 1
1: 8
2: 9
3: 4
4: 65
998322762_998322779 23 Left 998322762 5:141247584-141247606 CCTACCTGCCGCTCCCAGAGGCG 0: 1
1: 3
2: 11
3: 12
4: 187
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322762_998322778 20 Left 998322762 5:141247584-141247606 CCTACCTGCCGCTCCCAGAGGCG 0: 1
1: 3
2: 11
3: 12
4: 187
Right 998322778 5:141247627-141247649 CGACTCGCTTACCGTCTACCTGG 0: 1
1: 1
2: 15
3: 1
4: 12
998322762_998322769 -4 Left 998322762 5:141247584-141247606 CCTACCTGCCGCTCCCAGAGGCG 0: 1
1: 3
2: 11
3: 12
4: 187
Right 998322769 5:141247603-141247625 GGCGGCCCCGGCCCAAGCCCAGG 0: 2
1: 7
2: 10
3: 67
4: 658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322762 Original CRISPR CGCCTCTGGGAGCGGCAGGT AGG (reversed) Exonic