ID: 998322764

View in Genome Browser
Species Human (GRCh38)
Location 5:141247588-141247610
Sequence GGGCCGCCTCTGGGAGCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 2, 1: 1, 2: 12, 3: 39, 4: 380}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322764_998322779 19 Left 998322764 5:141247588-141247610 CCTGCCGCTCCCAGAGGCGGCCC 0: 2
1: 1
2: 12
3: 39
4: 380
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322764_998322778 16 Left 998322764 5:141247588-141247610 CCTGCCGCTCCCAGAGGCGGCCC 0: 2
1: 1
2: 12
3: 39
4: 380
Right 998322778 5:141247627-141247649 CGACTCGCTTACCGTCTACCTGG 0: 1
1: 1
2: 15
3: 1
4: 12
998322764_998322769 -8 Left 998322764 5:141247588-141247610 CCTGCCGCTCCCAGAGGCGGCCC 0: 2
1: 1
2: 12
3: 39
4: 380
Right 998322769 5:141247603-141247625 GGCGGCCCCGGCCCAAGCCCAGG 0: 2
1: 7
2: 10
3: 67
4: 658
998322764_998322780 22 Left 998322764 5:141247588-141247610 CCTGCCGCTCCCAGAGGCGGCCC 0: 2
1: 1
2: 12
3: 39
4: 380
Right 998322780 5:141247633-141247655 GCTTACCGTCTACCTGGTGGTGG 0: 1
1: 8
2: 9
3: 4
4: 65
998322764_998322782 28 Left 998322764 5:141247588-141247610 CCTGCCGCTCCCAGAGGCGGCCC 0: 2
1: 1
2: 12
3: 39
4: 380
Right 998322782 5:141247639-141247661 CGTCTACCTGGTGGTGGCATTGG 0: 3
1: 12
2: 3
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322764 Original CRISPR GGGCCGCCTCTGGGAGCGGC AGG (reversed) Exonic