ID: 998322768

View in Genome Browser
Species Human (GRCh38)
Location 5:141247598-141247620
Sequence GCTTGGGCCGGGGCCGCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 2, 1: 7, 2: 9, 3: 23, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322768_998322778 6 Left 998322768 5:141247598-141247620 CCAGAGGCGGCCCCGGCCCAAGC 0: 2
1: 7
2: 9
3: 23
4: 258
Right 998322778 5:141247627-141247649 CGACTCGCTTACCGTCTACCTGG 0: 1
1: 1
2: 15
3: 1
4: 12
998322768_998322782 18 Left 998322768 5:141247598-141247620 CCAGAGGCGGCCCCGGCCCAAGC 0: 2
1: 7
2: 9
3: 23
4: 258
Right 998322782 5:141247639-141247661 CGTCTACCTGGTGGTGGCATTGG 0: 3
1: 12
2: 3
3: 3
4: 102
998322768_998322779 9 Left 998322768 5:141247598-141247620 CCAGAGGCGGCCCCGGCCCAAGC 0: 2
1: 7
2: 9
3: 23
4: 258
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322768_998322780 12 Left 998322768 5:141247598-141247620 CCAGAGGCGGCCCCGGCCCAAGC 0: 2
1: 7
2: 9
3: 23
4: 258
Right 998322780 5:141247633-141247655 GCTTACCGTCTACCTGGTGGTGG 0: 1
1: 8
2: 9
3: 4
4: 65
998322768_998322784 24 Left 998322768 5:141247598-141247620 CCAGAGGCGGCCCCGGCCCAAGC 0: 2
1: 7
2: 9
3: 23
4: 258
Right 998322784 5:141247645-141247667 CCTGGTGGTGGCATTGGCCTCGG 0: 4
1: 11
2: 4
3: 37
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322768 Original CRISPR GCTTGGGCCGGGGCCGCCTC TGG (reversed) Exonic