ID: 998322771

View in Genome Browser
Species Human (GRCh38)
Location 5:141247609-141247631
Sequence AGTCGGCCTGGGCTTGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 2, 1: 7, 2: 5, 3: 67, 4: 345}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322771_998322784 13 Left 998322771 5:141247609-141247631 CCCGGCCCAAGCCCAGGCCGACT 0: 2
1: 7
2: 5
3: 67
4: 345
Right 998322784 5:141247645-141247667 CCTGGTGGTGGCATTGGCCTCGG 0: 4
1: 11
2: 4
3: 37
4: 315
998322771_998322778 -5 Left 998322771 5:141247609-141247631 CCCGGCCCAAGCCCAGGCCGACT 0: 2
1: 7
2: 5
3: 67
4: 345
Right 998322778 5:141247627-141247649 CGACTCGCTTACCGTCTACCTGG 0: 1
1: 1
2: 15
3: 1
4: 12
998322771_998322779 -2 Left 998322771 5:141247609-141247631 CCCGGCCCAAGCCCAGGCCGACT 0: 2
1: 7
2: 5
3: 67
4: 345
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322771_998322780 1 Left 998322771 5:141247609-141247631 CCCGGCCCAAGCCCAGGCCGACT 0: 2
1: 7
2: 5
3: 67
4: 345
Right 998322780 5:141247633-141247655 GCTTACCGTCTACCTGGTGGTGG 0: 1
1: 8
2: 9
3: 4
4: 65
998322771_998322782 7 Left 998322771 5:141247609-141247631 CCCGGCCCAAGCCCAGGCCGACT 0: 2
1: 7
2: 5
3: 67
4: 345
Right 998322782 5:141247639-141247661 CGTCTACCTGGTGGTGGCATTGG 0: 3
1: 12
2: 3
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322771 Original CRISPR AGTCGGCCTGGGCTTGGGCC GGG (reversed) Exonic