ID: 998322772

View in Genome Browser
Species Human (GRCh38)
Location 5:141247610-141247632
Sequence GAGTCGGCCTGGGCTTGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 2, 1: 6, 2: 7, 3: 30, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322772_998322780 0 Left 998322772 5:141247610-141247632 CCGGCCCAAGCCCAGGCCGACTC 0: 2
1: 6
2: 7
3: 30
4: 294
Right 998322780 5:141247633-141247655 GCTTACCGTCTACCTGGTGGTGG 0: 1
1: 8
2: 9
3: 4
4: 65
998322772_998322779 -3 Left 998322772 5:141247610-141247632 CCGGCCCAAGCCCAGGCCGACTC 0: 2
1: 6
2: 7
3: 30
4: 294
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322772_998322784 12 Left 998322772 5:141247610-141247632 CCGGCCCAAGCCCAGGCCGACTC 0: 2
1: 6
2: 7
3: 30
4: 294
Right 998322784 5:141247645-141247667 CCTGGTGGTGGCATTGGCCTCGG 0: 4
1: 11
2: 4
3: 37
4: 315
998322772_998322782 6 Left 998322772 5:141247610-141247632 CCGGCCCAAGCCCAGGCCGACTC 0: 2
1: 6
2: 7
3: 30
4: 294
Right 998322782 5:141247639-141247661 CGTCTACCTGGTGGTGGCATTGG 0: 3
1: 12
2: 3
3: 3
4: 102
998322772_998322778 -6 Left 998322772 5:141247610-141247632 CCGGCCCAAGCCCAGGCCGACTC 0: 2
1: 6
2: 7
3: 30
4: 294
Right 998322778 5:141247627-141247649 CGACTCGCTTACCGTCTACCTGG 0: 1
1: 1
2: 15
3: 1
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322772 Original CRISPR GAGTCGGCCTGGGCTTGGGC CGG (reversed) Exonic