ID: 998322773

View in Genome Browser
Species Human (GRCh38)
Location 5:141247614-141247636
Sequence AAGCGAGTCGGCCTGGGCTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 6, 3: 12, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322773_998322784 8 Left 998322773 5:141247614-141247636 CCCAAGCCCAGGCCGACTCGCTT 0: 1
1: 0
2: 6
3: 12
4: 60
Right 998322784 5:141247645-141247667 CCTGGTGGTGGCATTGGCCTCGG 0: 4
1: 11
2: 4
3: 37
4: 315
998322773_998322778 -10 Left 998322773 5:141247614-141247636 CCCAAGCCCAGGCCGACTCGCTT 0: 1
1: 0
2: 6
3: 12
4: 60
Right 998322778 5:141247627-141247649 CGACTCGCTTACCGTCTACCTGG 0: 1
1: 1
2: 15
3: 1
4: 12
998322773_998322779 -7 Left 998322773 5:141247614-141247636 CCCAAGCCCAGGCCGACTCGCTT 0: 1
1: 0
2: 6
3: 12
4: 60
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322773_998322780 -4 Left 998322773 5:141247614-141247636 CCCAAGCCCAGGCCGACTCGCTT 0: 1
1: 0
2: 6
3: 12
4: 60
Right 998322780 5:141247633-141247655 GCTTACCGTCTACCTGGTGGTGG 0: 1
1: 8
2: 9
3: 4
4: 65
998322773_998322782 2 Left 998322773 5:141247614-141247636 CCCAAGCCCAGGCCGACTCGCTT 0: 1
1: 0
2: 6
3: 12
4: 60
Right 998322782 5:141247639-141247661 CGTCTACCTGGTGGTGGCATTGG 0: 3
1: 12
2: 3
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322773 Original CRISPR AAGCGAGTCGGCCTGGGCTT GGG (reversed) Exonic