ID: 998322774

View in Genome Browser
Species Human (GRCh38)
Location 5:141247615-141247637
Sequence TAAGCGAGTCGGCCTGGGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322774_998322784 7 Left 998322774 5:141247615-141247637 CCAAGCCCAGGCCGACTCGCTTA 0: 1
1: 0
2: 5
3: 14
4: 69
Right 998322784 5:141247645-141247667 CCTGGTGGTGGCATTGGCCTCGG 0: 4
1: 11
2: 4
3: 37
4: 315
998322774_998322782 1 Left 998322774 5:141247615-141247637 CCAAGCCCAGGCCGACTCGCTTA 0: 1
1: 0
2: 5
3: 14
4: 69
Right 998322782 5:141247639-141247661 CGTCTACCTGGTGGTGGCATTGG 0: 3
1: 12
2: 3
3: 3
4: 102
998322774_998322780 -5 Left 998322774 5:141247615-141247637 CCAAGCCCAGGCCGACTCGCTTA 0: 1
1: 0
2: 5
3: 14
4: 69
Right 998322780 5:141247633-141247655 GCTTACCGTCTACCTGGTGGTGG 0: 1
1: 8
2: 9
3: 4
4: 65
998322774_998322779 -8 Left 998322774 5:141247615-141247637 CCAAGCCCAGGCCGACTCGCTTA 0: 1
1: 0
2: 5
3: 14
4: 69
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322774 Original CRISPR TAAGCGAGTCGGCCTGGGCT TGG (reversed) Exonic