ID: 998322779

View in Genome Browser
Species Human (GRCh38)
Location 5:141247630-141247652
Sequence CTCGCTTACCGTCTACCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 2, 2: 15, 3: 1, 4: 50}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322771_998322779 -2 Left 998322771 5:141247609-141247631 CCCGGCCCAAGCCCAGGCCGACT 0: 2
1: 7
2: 5
3: 67
4: 345
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322762_998322779 23 Left 998322762 5:141247584-141247606 CCTACCTGCCGCTCCCAGAGGCG 0: 1
1: 3
2: 11
3: 12
4: 187
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322766_998322779 15 Left 998322766 5:141247592-141247614 CCGCTCCCAGAGGCGGCCCCGGC 0: 1
1: 7
2: 6
3: 33
4: 301
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322773_998322779 -7 Left 998322773 5:141247614-141247636 CCCAAGCCCAGGCCGACTCGCTT 0: 1
1: 0
2: 6
3: 12
4: 60
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322772_998322779 -3 Left 998322772 5:141247610-141247632 CCGGCCCAAGCCCAGGCCGACTC 0: 2
1: 6
2: 7
3: 30
4: 294
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322764_998322779 19 Left 998322764 5:141247588-141247610 CCTGCCGCTCCCAGAGGCGGCCC 0: 2
1: 1
2: 12
3: 39
4: 380
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322767_998322779 10 Left 998322767 5:141247597-141247619 CCCAGAGGCGGCCCCGGCCCAAG 0: 1
1: 1
2: 8
3: 22
4: 191
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322761_998322779 24 Left 998322761 5:141247583-141247605 CCCTACCTGCCGCTCCCAGAGGC 0: 1
1: 3
2: 12
3: 17
4: 214
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322768_998322779 9 Left 998322768 5:141247598-141247620 CCAGAGGCGGCCCCGGCCCAAGC 0: 2
1: 7
2: 9
3: 23
4: 258
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322770_998322779 -1 Left 998322770 5:141247608-141247630 CCCCGGCCCAAGCCCAGGCCGAC 0: 2
1: 7
2: 2
3: 31
4: 303
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322774_998322779 -8 Left 998322774 5:141247615-141247637 CCAAGCCCAGGCCGACTCGCTTA 0: 1
1: 0
2: 5
3: 14
4: 69
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322779 Original CRISPR CTCGCTTACCGTCTACCTGG TGG Exonic