ID: 998322779

View in Genome Browser
Species Human (GRCh38)
Location 5:141247630-141247652
Sequence CTCGCTTACCGTCTACCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 2, 2: 15, 3: 1, 4: 50}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998322768_998322779 9 Left 998322768 5:141247598-141247620 CCAGAGGCGGCCCCGGCCCAAGC 0: 2
1: 7
2: 9
3: 23
4: 258
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322762_998322779 23 Left 998322762 5:141247584-141247606 CCTACCTGCCGCTCCCAGAGGCG 0: 1
1: 3
2: 11
3: 12
4: 187
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322773_998322779 -7 Left 998322773 5:141247614-141247636 CCCAAGCCCAGGCCGACTCGCTT 0: 1
1: 0
2: 6
3: 12
4: 60
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322764_998322779 19 Left 998322764 5:141247588-141247610 CCTGCCGCTCCCAGAGGCGGCCC 0: 2
1: 1
2: 12
3: 39
4: 380
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322771_998322779 -2 Left 998322771 5:141247609-141247631 CCCGGCCCAAGCCCAGGCCGACT 0: 2
1: 7
2: 5
3: 67
4: 345
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322767_998322779 10 Left 998322767 5:141247597-141247619 CCCAGAGGCGGCCCCGGCCCAAG 0: 1
1: 1
2: 8
3: 22
4: 191
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322774_998322779 -8 Left 998322774 5:141247615-141247637 CCAAGCCCAGGCCGACTCGCTTA 0: 1
1: 0
2: 5
3: 14
4: 69
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322766_998322779 15 Left 998322766 5:141247592-141247614 CCGCTCCCAGAGGCGGCCCCGGC 0: 1
1: 7
2: 6
3: 33
4: 301
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322761_998322779 24 Left 998322761 5:141247583-141247605 CCCTACCTGCCGCTCCCAGAGGC 0: 1
1: 3
2: 12
3: 17
4: 214
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322770_998322779 -1 Left 998322770 5:141247608-141247630 CCCCGGCCCAAGCCCAGGCCGAC 0: 2
1: 7
2: 2
3: 31
4: 303
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50
998322772_998322779 -3 Left 998322772 5:141247610-141247632 CCGGCCCAAGCCCAGGCCGACTC 0: 2
1: 6
2: 7
3: 30
4: 294
Right 998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG 0: 1
1: 2
2: 15
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998322779 Original CRISPR CTCGCTTACCGTCTACCTGG TGG Exonic
902883832 1:19390733-19390755 CTCCCTTACCTTCTACCTTCTGG - Intronic
903614772 1:24643613-24643635 CTCGCTGCCCGCCTGCCTGGCGG + Intronic
1068439030 10:57028407-57028429 CTCTCTTACCCTCCACCAGGAGG + Intergenic
1083099655 11:60289356-60289378 CTCGCTTACCTTCTCCCTGCAGG + Intronic
1095927308 12:47591858-47591880 CCTGCTTACCATCTTCCTGGGGG - Intergenic
1097940021 12:65293958-65293980 CTTCCTTCCCCTCTACCTGGAGG - Intronic
1104816652 12:131650073-131650095 CTCACTTACCTTCTACCCAGTGG + Intergenic
1106043350 13:26115027-26115049 CGCACTTAACATCTACCTGGGGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1116305485 14:43248831-43248853 CTCACTTTCCTTCTGCCTGGGGG + Intergenic
1118303612 14:64636401-64636423 CTCTCTCACGGTCTCCCTGGAGG + Intergenic
1119439067 14:74616099-74616121 CTCCCTTACCCTCTAACTGCTGG + Intergenic
1202851307 14_GL000225v1_random:22096-22118 CTTGCTTACGCTCTACCTGCAGG - Intergenic
1202858602 14_GL000225v1_random:66183-66205 CTTGCTTACCCTCTGCCTGCAGG + Intergenic
1124099004 15:26675816-26675838 CTCATTTACCATCTGCCTGGTGG - Intronic
1129463475 15:75711455-75711477 CTCCCTTCCCATCTCCCTGGCGG + Intronic
1129721412 15:77879947-77879969 CTCCCTTCCCATCTCCCTGGCGG - Intergenic
1131437092 15:92431811-92431833 CTCAGTTGCAGTCTACCTGGGGG - Intronic
1143531626 17:7508421-7508443 TTCGCTTACTGTCTTCCTGTTGG + Exonic
1147131978 17:38415095-38415117 CTCGCTCTCCCTCCACCTGGAGG - Intergenic
1151936493 17:77265162-77265184 ATCACTCACCATCTACCTGGGGG + Intergenic
1152474939 17:80511994-80512016 CTCGCTCACCGCCCACCTGCCGG - Intergenic
1153336492 18:3931017-3931039 GGAGCTTACCGTCTTCCTGGAGG - Intronic
1155557172 18:27032702-27032724 CTTGCCTAATGTCTACCTGGTGG - Intronic
1158387246 18:57008766-57008788 GTCGCTTACTGTCAACCTGTTGG + Intronic
1161604484 19:5207049-5207071 CTCTCCTCCCGTCTGCCTGGAGG + Intronic
926817550 2:16814791-16814813 CTCTCTTACTCTCTACCTGCTGG + Intergenic
935535480 2:104288149-104288171 CTGGCTTACCGACTGCCTGCAGG - Intergenic
937595040 2:123662040-123662062 CTCTCTTTCCGTCTTTCTGGAGG - Intergenic
947333750 2:229058052-229058074 CTGGCTTCTCCTCTACCTGGGGG - Intronic
1170591142 20:17772952-17772974 CTAGCTTGCCTTCTAGCTGGAGG + Intergenic
1171202318 20:23252015-23252037 CTGGCTTACCCTCTCCATGGTGG + Intergenic
1175105465 20:56611611-56611633 CTGGCTTAAAGTCTTCCTGGTGG + Intergenic
1179250502 21:39667707-39667729 CCAGGTTACTGTCTACCTGGTGG + Exonic
1181036437 22:20171870-20171892 CTGGCTCACCGCCCACCTGGAGG - Intergenic
955325780 3:58008557-58008579 CTCGGTTACCGGCATCCTGGTGG - Exonic
959616731 3:108357167-108357189 CTGGCTTCCAGTCTACCTGCAGG - Intronic
992833652 5:80619438-80619460 CTTACTTACTGTGTACCTGGTGG - Intergenic
997290604 5:132730718-132730740 CTCACTTAGCGTCTACCTCCCGG - Intronic
998307891 5:141096848-141096870 CTTGCTCACCGTCTACCTGGTGG + Exonic
998308527 5:141102701-141102723 CTTGCTCACCGTCTACCTGGTGG + Exonic
998310434 5:141124047-141124069 CTCTCTCACCGTCTACCTGGTGG + Exonic
998311592 5:141137483-141137505 CTCGCTCACTGTCTACCTGGTGG + Exonic
998312873 5:141152303-141152325 CTCTCTCACCGTCTACCTGGTGG + Exonic
998313568 5:141158052-141158074 CTCGCTCACCGTCTACCTGGTGG + Intergenic
998315059 5:141174881-141174903 CTCGCTCACCGTCTACCTGGTGG + Exonic
998315637 5:141180089-141180111 CTCTCTCACCGTCTACCTGGTGG + Exonic
998316178 5:141184611-141184633 CTCGCTCACTGTCTACCTGGTGG + Exonic
998316738 5:141189370-141189392 CTTGCTCACCGTCTACCTGGTGG + Exonic
998317372 5:141194610-141194632 CTTGCTCACCGTCTACCTGGTGG + Exonic
998318040 5:141201826-141201848 CTCGCTCACCGTCTACTTGGTGG + Exonic
998319002 5:141210959-141210981 CTCGCTCACTGTCTACCTGGTGG + Exonic
998319566 5:141216175-141216197 CTTGCTCACCGTCTACCTGGTGG + Exonic
998320543 5:141225557-141225579 CTCCCTCACCGTCTACCTGGTGG + Exonic
998321553 5:141236606-141236628 CTCCCTCACCGTCTACCTGGTGG + Intergenic
998322114 5:141241962-141241984 CTTGCTCACCGTCTACCTGGTGG + Intergenic
998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG + Exonic
1017223591 6:151994514-151994536 CACCCTTACGGTCTATCTGGAGG - Intronic
1019094139 6:169564994-169565016 CTCGCTGACAGCGTACCTGGTGG - Intronic
1031955687 7:127940128-127940150 CTGGCTTGCCTTCCACCTGGTGG + Intronic
1035536619 8:395897-395919 CTTACTTACAGCCTACCTGGAGG + Intergenic
1055700066 9:78934522-78934544 GTGGCTAACCGTCTACCTGTAGG - Intergenic
1056665352 9:88577021-88577043 CTCCCTCACCCTCTACCTTGAGG - Intronic
1059688787 9:116663421-116663443 CTCTCTTACTGTTTTCCTGGGGG + Intronic
1198854742 X:141003816-141003838 CTGGCTTACTGTCAACCTGTGGG - Intergenic
1198877272 X:141241326-141241348 CTGGCTTACTGTCAACCTGTGGG + Intergenic
1198907954 X:141583547-141583569 CTGGCTTACTGTCAACCTGTGGG + Intergenic
1198908837 X:141590877-141590899 CTGGCTTACTGTCAACCTGTGGG - Intronic
1198918236 X:141697279-141697301 CTGGCTTACTGTCAACCTGTGGG + Intronic