ID: 998323081

View in Genome Browser
Species Human (GRCh38)
Location 5:141250937-141250959
Sequence GTTAATGCAAATTGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998323081_998323084 10 Left 998323081 5:141250937-141250959 CCAGCTCCTCAATTTGCATTAAC No data
Right 998323084 5:141250970-141250992 ATTTGCATGTAAGTGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998323081 Original CRISPR GTTAATGCAAATTGAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr