ID: 998323082

View in Genome Browser
Species Human (GRCh38)
Location 5:141250943-141250965
Sequence AGGTGAGTTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998323082_998323084 4 Left 998323082 5:141250943-141250965 CCTCAATTTGCATTAACTCACCT No data
Right 998323084 5:141250970-141250992 ATTTGCATGTAAGTGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998323082 Original CRISPR AGGTGAGTTAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr