ID: 998323084

View in Genome Browser
Species Human (GRCh38)
Location 5:141250970-141250992
Sequence ATTTGCATGTAAGTGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998323082_998323084 4 Left 998323082 5:141250943-141250965 CCTCAATTTGCATTAACTCACCT No data
Right 998323084 5:141250970-141250992 ATTTGCATGTAAGTGAAAATAGG No data
998323081_998323084 10 Left 998323081 5:141250937-141250959 CCAGCTCCTCAATTTGCATTAAC No data
Right 998323084 5:141250970-141250992 ATTTGCATGTAAGTGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998323084 Original CRISPR ATTTGCATGTAAGTGAAAAT AGG Intergenic
No off target data available for this crispr