ID: 998332366

View in Genome Browser
Species Human (GRCh38)
Location 5:141340367-141340389
Sequence GAGAAGACAGAGGCTCCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998332366 Original CRISPR GAGAAGACAGAGGCTCCTCT GGG (reversed) Exonic
900001936 1:19307-19329 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
900001955 1:19377-19399 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
900021656 1:189830-189852 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
900021675 1:189900-189922 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
900261888 1:1735326-1735348 GACAAGACAGAGACTTCTCTGGG + Intronic
900477895 1:2884491-2884513 AAGAAGACAGGGGTTCCTCCCGG - Intergenic
900525261 1:3125413-3125435 GCGATGACAGTGGCTACTCTGGG - Intronic
900612725 1:3551172-3551194 GAGACACCAGAGGCTCCGCTTGG + Intronic
900777676 1:4596751-4596773 CAGAAGACAGAGGAGCCTCCTGG + Intergenic
900886828 1:5421169-5421191 GAGAAAACAGGGGTTCCTCTGGG - Intergenic
901215569 1:7552976-7552998 GTGAGGACAGAGGGACCTCTGGG + Intronic
901826307 1:11863938-11863960 CAGAAGACAGAGGCACTACTGGG - Intergenic
902270818 1:15303319-15303341 GAAGAGAAAGAGGCTCCTCAAGG - Intronic
902542471 1:17164857-17164879 GCGGAGACAGAAGCTCTTCTAGG + Intergenic
903257690 1:22113917-22113939 GACCAGGCAGTGGCTCCTCTGGG - Intergenic
903502032 1:23805934-23805956 AAAAAAAAAGAGGCTCCTCTGGG - Intronic
904461823 1:30685242-30685264 GAGGAGAGCGAGGCTCCTCCGGG + Intergenic
904466462 1:30710963-30710985 GAGAAGACAGGAGCTGCTCAGGG - Intergenic
905756674 1:40515885-40515907 GAGAAGACAGATGCTCATCATGG + Exonic
905770334 1:40633866-40633888 GAGAAAACAGAGGCTCCAAAAGG + Intronic
907114723 1:51958776-51958798 GGGAGGTCTGAGGCTCCTCTTGG - Intronic
907311863 1:53543405-53543427 GAGGAGACAGAGGCTCCCAGAGG + Intronic
907470458 1:54670505-54670527 GAGAATCCAGTGGCTCCTCCTGG - Exonic
908027429 1:59967725-59967747 GAGAAGAAATAGGCTGCACTGGG + Intergenic
910226784 1:84943982-84944004 GAGGAAACAGAGGCAGCTCTTGG + Intronic
910467490 1:87515784-87515806 AAGAATACAGGGGCTCTTCTGGG + Intergenic
910596683 1:88988318-88988340 AAGAGAGCAGAGGCTCCTCTGGG + Exonic
911540163 1:99147713-99147735 GAGAAGTCAGAGGCTCATTTAGG + Intergenic
912730490 1:112098388-112098410 GAGAAGACAGAGTTTCTTCTAGG + Intergenic
912960416 1:114191047-114191069 GAGAAGACATAGCATACTCTAGG - Intergenic
913380161 1:118201927-118201949 CAGATTACAGAAGCTCCTCTTGG + Intergenic
913974938 1:143448463-143448485 GAGAAAACAGAAGCTCCTCAAGG + Intergenic
914069330 1:144274080-144274102 GAGAAAACAGAAGCTCCTCAAGG + Intergenic
914109825 1:144692274-144692296 GAGAAAACAGAAGCTCCTCAAGG - Intergenic
915073507 1:153291468-153291490 GAGAAAACTGAGGCTCAGCTTGG - Intergenic
915347466 1:155205032-155205054 CAGAACTCAGAGGCTCCTCCCGG + Intronic
915519809 1:156435588-156435610 GAGCAGGCAGAGGCGCCTCGGGG - Intergenic
916273278 1:162967120-162967142 GAGAAGACAGAGGCAGCAATTGG - Intergenic
916429857 1:164717359-164717381 GGGAAGAGAGAGGCTCTTCTTGG + Intronic
917620666 1:176792460-176792482 GGGAATTCAGATGCTCCTCTTGG + Intronic
920696162 1:208182819-208182841 CAGCAGCCAGAGTCTCCTCTAGG - Intronic
920741255 1:208583158-208583180 GAGGACACAGGGGCTCCTGTGGG - Intergenic
920843805 1:209576853-209576875 GGGAGGACACAGGCACCTCTGGG + Intergenic
921750273 1:218784064-218784086 GAGGAGAAAAAGGCTCCTCTGGG - Intergenic
922343016 1:224672602-224672624 GTGAAGACAGAGGCTGCAATTGG - Intronic
1063957527 10:11280733-11280755 GAGTGGACAGAGGCCGCTCTGGG + Intronic
1066654014 10:37682770-37682792 GAGAGCAGAGAGGCTTCTCTTGG + Intergenic
1067038436 10:42935460-42935482 GAGAGCAAAGAGGCTTCTCTTGG + Intergenic
1067233534 10:44427872-44427894 GGGCAGTCAGAGGCTCCTCCTGG + Intergenic
1067275049 10:44826714-44826736 GGGAAGACTGGGGCTTCTCTAGG + Intergenic
1067971074 10:50971463-50971485 GAGGAGAGAGAGTCTTCTCTAGG - Intergenic
1071562656 10:86655809-86655831 GAGAAGACAGAGCCAACTCCTGG - Intronic
1072234902 10:93445505-93445527 AAGGAGACAGAGGAGCCTCTTGG - Intronic
1072526751 10:96278328-96278350 GAGGAGGGAGAGGATCCTCTTGG - Intergenic
1074539842 10:114355226-114355248 GAGAAGAGAAAGGCTTCTGTGGG - Intronic
1075052602 10:119193964-119193986 GACAAGACAGCGTCTCCTTTGGG - Intergenic
1077043542 11:534925-534947 GAGAAGACAGAGGAGCTCCTGGG + Intronic
1077118866 11:897729-897751 AAGCAGACAGAGGAGCCTCTTGG + Intronic
1077190340 11:1253415-1253437 CAGGAGACAAAAGCTCCTCTGGG - Intronic
1077492185 11:2866689-2866711 GAGAAGGCAGGGGCACCTCCAGG - Intergenic
1078778932 11:14419005-14419027 GATAAGACAGAGGGTGCTCAAGG - Intergenic
1078788430 11:14519943-14519965 GAGAAGACAGAGACTTGACTTGG - Intronic
1078791918 11:14552101-14552123 GAGAGGAAAGAGGCTTCTCTAGG + Intronic
1078884338 11:15485054-15485076 GAGAAGAGAGTGACTTCTCTGGG - Intergenic
1079259665 11:18866180-18866202 AAGAAGACACACCCTCCTCTGGG + Intergenic
1080808878 11:35682475-35682497 CAGAAGGCAGAGGCTCCTCGGGG - Intronic
1080886568 11:36373764-36373786 AAGATGAAAGAGTCTCCTCTGGG - Intronic
1081129186 11:39355947-39355969 GACAAGCCAGAGGCTCACCTAGG - Intergenic
1081556859 11:44172286-44172308 GAGCAGTCAGAAGCTGCTCTTGG + Intronic
1081651212 11:44825349-44825371 GAGAAGACTGAGGCCCCACCAGG + Intronic
1083486436 11:62985559-62985581 CAGAAGTCAGAGGCCGCTCTTGG + Intergenic
1083926668 11:65811421-65811443 GAGGACACAGTGCCTCCTCTGGG + Intergenic
1084755925 11:71238595-71238617 GAGAGGCCAGAGGCCCCTCCTGG + Intronic
1084938541 11:72600316-72600338 GACAAGACAGAGGCTGAGCTGGG + Intronic
1085694492 11:78692403-78692425 GAGAAAACAGAGGCTCACCGAGG - Intronic
1086123713 11:83327981-83328003 GAGAAGACAGAGGTCCCACAAGG + Intergenic
1086146210 11:83555092-83555114 GATTAGACAGCAGCTCCTCTTGG - Intronic
1087118369 11:94546277-94546299 AAGAAGTCAGCGGCCCCTCTTGG - Exonic
1087221340 11:95549630-95549652 GAAAAGACAGTGGCTGCTCAAGG + Intergenic
1087735256 11:101825937-101825959 GAGAAGACAGAGATTTCTCTTGG - Intronic
1090409981 11:126501400-126501422 GAGACTAAGGAGGCTCCTCTGGG + Intronic
1090843954 11:130515762-130515784 GAGAGGACAGAGGAAACTCTAGG + Intergenic
1091055923 11:132418947-132418969 TAGAAAACACAGGCTCTTCTGGG + Exonic
1091171307 11:133521839-133521861 GAGAAGCCAAAGGCTTCTGTAGG + Intronic
1091207826 11:133833216-133833238 GAGAAGGCAGCAGCTGCTCTCGG - Intergenic
1091375016 12:19412-19434 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
1091617383 12:2059750-2059772 GAGAAAACAGAGGCCCCTAAAGG + Intronic
1093161788 12:15755411-15755433 GAGATGTCAGAAGCTCATCTTGG - Intronic
1093691669 12:22116027-22116049 GAAAAGACAGAGGGTCCACTGGG - Intronic
1093905980 12:24692253-24692275 CTGAAGACTGATGCTCCTCTTGG + Intergenic
1094102966 12:26783368-26783390 GAGAAGACAGCCACTTCTCTTGG - Intronic
1095232946 12:39763632-39763654 GAGATGAGAGAAGCTCTTCTGGG + Intronic
1096370384 12:51064276-51064298 GGACAGCCAGAGGCTCCTCTAGG + Exonic
1096911126 12:54984908-54984930 GGAAAGACAGAGGCAGCTCTGGG - Intergenic
1098476143 12:70906205-70906227 GAGAAGACTGAGGCTCATTGGGG - Intronic
1099387220 12:82029223-82029245 AAGAAGCCAGAGACCCCTCTGGG - Intergenic
1101436469 12:104668852-104668874 GAGAAGACCCAGGCAACTCTGGG + Intronic
1101544749 12:105701957-105701979 GAGAAAACTGAGGCTCATGTTGG - Intergenic
1101574489 12:105984959-105984981 GTGAATTCAGAGGCTCTTCTTGG + Intergenic
1103361550 12:120357437-120357459 GAGAAGACTGGGGCTCCTTGTGG - Intronic
1103961244 12:124610410-124610432 GGGTAGAGAGAGGCTCTTCTCGG - Intergenic
1104650745 12:130530769-130530791 GAGAAGACAGAAGCTCTTTAGGG - Intronic
1105605508 13:21923543-21923565 GAGAAGACAGAGGCTTCAAGAGG + Intergenic
1106002718 13:25739252-25739274 GAGCAGACAGCAGCTCCTCCTGG - Intronic
1106206338 13:27599324-27599346 GAGTAAACAAAGGCTCCTTTTGG - Intronic
1106389500 13:29321213-29321235 GAGAAGGCTGAGGCTGCACTGGG + Intronic
1107040327 13:35941100-35941122 GAGAAGACACAGTCTCATCCAGG - Intronic
1109309932 13:60680475-60680497 GAGAAAACATTGGCTCCTCCTGG - Intergenic
1110233177 13:73187924-73187946 GAAAAGACTGAGGTTCCCCTGGG + Intergenic
1110729865 13:78867502-78867524 GAGATAACAGAGGCTCCCCATGG - Intergenic
1111923141 13:94433455-94433477 GAGAAAACAAATCCTCCTCTAGG - Intergenic
1112601519 13:100860109-100860131 GAGAAGACATGGCCTCCTCCTGG + Intergenic
1113681521 13:112248101-112248123 GAGAAGAGAGAGGATCCCCCTGG + Intergenic
1119005700 14:70925805-70925827 GAGGAAACAGAGGCTCCTAGGGG + Intronic
1120457806 14:84754702-84754724 TAGAGGACAGTGGCTCCTCTAGG - Intergenic
1121267796 14:92615604-92615626 GAGAGGGCACAGGCCCCTCTGGG + Intronic
1121440998 14:93949372-93949394 GAGAAAACCGAGGCTCCTAAAGG - Intronic
1121533899 14:94677925-94677947 GTGATGACAGAGGCGGCTCTTGG + Intergenic
1121667052 14:95680502-95680524 GAGAAGACAAAGGCTCACCAGGG + Intergenic
1122359298 14:101150194-101150216 GAGAAGGCAGTGGTTCCCCTGGG - Intergenic
1122922004 14:104884187-104884209 GAGAAGACAGAGGAACGGCTGGG + Exonic
1125139676 15:36390172-36390194 GAAAAGAAAGAGGCTTCTATAGG + Intergenic
1125430623 15:39589695-39589717 GAGTAGACAGAGGCTCCATTTGG - Intronic
1128521033 15:68375130-68375152 GAGAGGTGAGAGGCTCCTGTGGG - Intronic
1130224733 15:82047642-82047664 TCGAAGGCAGAGGCTCCCCTAGG + Intergenic
1131032742 15:89200032-89200054 GAGTAGACAGCTGCTCCTTTTGG + Exonic
1132049212 15:98592811-98592833 GATAAGAGTGAGACTCCTCTCGG + Intergenic
1132368654 15:101277387-101277409 GCGCGGACAGAGACTCCTCTTGG + Exonic
1132451555 15:101971562-101971584 GAGAAGGCAGAGGCGCGACTGGG - Intergenic
1132451574 15:101971632-101971654 GAGAAGGCAGAGGCGCGACTGGG - Intergenic
1132455316 16:18996-19018 GAGAAGGCAGAGGCGCGACTGGG + Exonic
1132455335 16:19066-19088 GAGAAGGCAGAGGCGCGACTGGG + Exonic
1132781658 16:1629880-1629902 GTGAAGACAGAAGCTGCTGTGGG - Intronic
1133658722 16:7893129-7893151 GAGAAGACAGTACTTCCTCTTGG + Intergenic
1136127023 16:28191354-28191376 GTGAAGACAGAGCCTACTCTTGG - Intronic
1136288941 16:29260147-29260169 GAGCAGACAGAGGCTCCCCCAGG - Intergenic
1136487838 16:30584810-30584832 ATGAAGACAGATGTTCCTCTTGG - Intronic
1136713549 16:32259292-32259314 GAGAAGACAGCCTCTCCTGTGGG - Intergenic
1136754362 16:32670139-32670161 GAGAAGACAGCCTCTCCTGTGGG + Intergenic
1136813751 16:33200226-33200248 GAGAAGACAGCCTCTCCTGTGGG - Intronic
1136820227 16:33310306-33310328 GAGAAGACAGCCTCTCCTGTGGG - Intergenic
1136826790 16:33366845-33366867 GAGAAGACAGCCTCTCCTGTGGG - Intergenic
1136831856 16:33465616-33465638 GAGAAGACAGCCTCTCCTGTGGG - Intergenic
1139110688 16:63886995-63887017 GAGAAGCCAGTGGCTCCACCAGG - Intergenic
1141326251 16:83062127-83062149 GGAAAGACAGAGCCTGCTCTAGG + Intronic
1141395219 16:83698557-83698579 GGGCAGACAGGGGCTGCTCTTGG + Intronic
1141497542 16:84420293-84420315 GATAGGCCAGAGACTCCTCTGGG - Intronic
1141788407 16:86216933-86216955 GAGAAGGCAGAGGCTCCAAGAGG - Intergenic
1141984401 16:87570657-87570679 GAGAACACAGAAGCTCCTAGGGG + Intergenic
1142094668 16:88233054-88233076 GAGCAGACAGAGGCTCCCCCGGG - Intergenic
1202992327 16_KI270728v1_random:23200-23222 GAGAAGACAGCCTCTCCTGTGGG - Intergenic
1203056509 16_KI270728v1_random:930470-930492 GAGAAGACAGCCTCTCCTGTGGG + Intergenic
1145199435 17:20929231-20929253 GAGGAGACAGAAGCTCCTGCTGG - Intergenic
1146571904 17:33960211-33960233 GAGAAGACAGAGGTTGCTGCTGG - Intronic
1147232608 17:39030219-39030241 GAGAAGACTCAGCCTCCTCAGGG - Intergenic
1147872600 17:43598190-43598212 GAGAAGACACAGCCTCATCCAGG + Intergenic
1147959166 17:44155606-44155628 AAGAAGCCAGCTGCTCCTCTAGG - Intronic
1148329703 17:46806502-46806524 GAGAAAACTGAGGCTCAGCTGGG - Intronic
1148848225 17:50541381-50541403 AAGAGGACAGAGGCTGCTCGGGG - Intronic
1149630349 17:58116719-58116741 GGGAAGACAGAGACTACTTTTGG + Intergenic
1149755648 17:59183247-59183269 GAGAAGACACAGCCTCTGCTGGG - Intronic
1151192403 17:72408079-72408101 GAGGTGACACAGGCCCCTCTAGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1151733167 17:75922886-75922908 GAGAAGACAGAGGGTCCCTGAGG - Intronic
1152945520 17:83195616-83195638 GTGAAGGCAGTGGCTCCTCCCGG - Intergenic
1153151894 18:2105324-2105346 GAGAAGACAAAGCCACCTTTAGG - Intergenic
1155539931 18:26858560-26858582 GAGAAGATAAAGGCTCATATGGG - Intronic
1156267638 18:35502962-35502984 GAGAAAACACAGGCTACTTTAGG - Intergenic
1156460855 18:37320600-37320622 GAGAGGACAGAGTCTCTACTCGG + Intronic
1157530470 18:48416179-48416201 GTGAAGACAGAGGCAGCTATTGG + Intergenic
1157551507 18:48584993-48585015 GAAAGGACAGAGGCACCTATTGG + Intronic
1157832499 18:50869574-50869596 AAGAAGACACAAGCTCTTCTTGG - Intergenic
1157921576 18:51718530-51718552 GAGAGGACTGAGGCTCTTCTGGG + Intergenic
1158493047 18:57927969-57927991 GAGAAGACTGAGGGTCTTGTAGG + Intergenic
1159453533 18:68632622-68632644 GAGCAGCCAGAGGGTCCTTTTGG + Intergenic
1160633688 19:60915-60937 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
1160633707 19:60985-61007 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
1161511850 19:4676415-4676437 GTGAAGGCAGCGGCTCCTCGGGG + Exonic
1161740798 19:6019976-6019998 AAGAAGCCAGAGGCTTCCCTTGG + Intronic
1162575240 19:11495387-11495409 GAGGAGACAGAGGCAGCTCAAGG + Intronic
1163013645 19:14440771-14440793 GAGAAGACAGGGCCTGCCCTTGG + Intronic
1164063799 19:21696743-21696765 GAGGGGACTTAGGCTCCTCTTGG + Intergenic
1164562136 19:29299695-29299717 GAGTGGGCAGAGGCTGCTCTGGG + Intergenic
1165272506 19:34723189-34723211 GAGAGGACTTAGGCTCCTTTTGG - Intergenic
1165279250 19:34782663-34782685 GTGAGGACAGAGCCGCCTCTGGG + Intergenic
1165446620 19:35860301-35860323 AAGCAGACAGAGTCACCTCTGGG - Exonic
1166293972 19:41879899-41879921 GAGAAGAATGAGACTCTTCTTGG - Intronic
1168107372 19:54173070-54173092 CAGAAGCCTGGGGCTCCTCTAGG - Exonic
1168687726 19:58358512-58358534 GAGGAGCAAGAGGCTCCCCTGGG - Exonic
1168707359 19:58477679-58477701 CAGAAGACAGAGGAACCACTTGG + Exonic
926153062 2:10435239-10435261 CACAAGTCAGGGGCTCCTCTGGG - Intergenic
927205788 2:20609496-20609518 CCGAATACTGAGGCTCCTCTTGG + Intronic
927357332 2:22188068-22188090 GAGAAGAAAAAGGCTCCTGGGGG - Intergenic
927578265 2:24218939-24218961 GATAAGACACAGACTCCTCCTGG + Intronic
927886492 2:26721676-26721698 GGGGAGACAGAGGCAGCTCTGGG - Intronic
928868876 2:35951055-35951077 GAGAAGCCAAAGGCTTCTTTGGG + Intergenic
931101579 2:59007831-59007853 GAGAAGGCAGAGGCTACTACTGG - Intergenic
931704383 2:64935217-64935239 AAGGAAACCGAGGCTCCTCTAGG - Intergenic
932614018 2:73220525-73220547 GAGAAAACATAGGGTGCTCTGGG - Intronic
933799747 2:85951336-85951358 GAGAAAACTGAGGCTCAGCTTGG + Intergenic
934179641 2:89609442-89609464 GAGAAAACAGAAGCTCCTCAAGG + Intergenic
934289932 2:91683701-91683723 GAGATAACAGAAGCTCCTCAAGG + Intergenic
934761812 2:96860811-96860833 GAGAAGGCAGAGGCTGGCCTGGG + Exonic
934858570 2:97744427-97744449 GAGAAGACTGAAGCTCCCCAAGG - Intergenic
935014057 2:99163278-99163300 GAGAAGAAAGAGGATCCTAGAGG - Intronic
935697285 2:105781164-105781186 GACAACACAAAGGCACCTCTAGG - Intronic
935845349 2:107160118-107160140 GAGAAGAAGGAAGCTCCTGTAGG + Intergenic
936567767 2:113594028-113594050 GAGAAGGCAGAGGCGCGACTGGG - Intergenic
936567786 2:113594098-113594120 GAGAAGGCAGAGGCGCGACTGGG - Intergenic
937350231 2:121155875-121155897 TTGATGACAGAGGCTGCTCTGGG - Intergenic
939875902 2:147577567-147577589 GAGAACACAGAGGCTCTTTTTGG - Intergenic
946302167 2:218830673-218830695 GACCAGACCCAGGCTCCTCTGGG + Intronic
946479932 2:220045401-220045423 GAGATGTCAGAGGCTCCTCAGGG - Intergenic
948058678 2:235028087-235028109 GAGACAAAAGAGGCTGCTCTTGG - Intronic
948382217 2:237558817-237558839 AAGAACACAGAGCCTTCTCTTGG + Intergenic
948691028 2:239705190-239705212 GAGGAGACAGACGCTCCTGGAGG - Intergenic
1169835632 20:9874580-9874602 GATAAGACGGAGGCTCTTGTTGG + Intergenic
1169947637 20:11006417-11006439 GTGAAGACAGAGGAACATCTTGG - Intergenic
1170586680 20:17740062-17740084 GAGGAGACAGAGGCTCAGCAAGG - Intergenic
1170954224 20:20963806-20963828 GAGAACACAGAGGCTGATCTGGG + Intergenic
1171867666 20:30500247-30500269 GAGAAGACGGAGGCTCACCTGGG + Intergenic
1171907602 20:30912497-30912519 GAGAAGACGGAGGCACACCTGGG - Intergenic
1171947027 20:31387811-31387833 GGGCAGGCAGAGGCTCCTCGTGG + Intronic
1172476361 20:35241193-35241215 GAGAAGGCAGAGGATTGTCTGGG + Intronic
1172630766 20:36376796-36376818 GAGAAAACTGAGGCTCCACAAGG - Intronic
1173581911 20:44153138-44153160 GAGAAGACAGGGCCTTCCCTTGG + Intronic
1174169695 20:48608342-48608364 GAGAAAACGGAGGCTCCTTAGGG - Intergenic
1175537117 20:59722502-59722524 GTGAGGCCAGAGGCTCCTCAGGG + Intronic
1176124838 20:63470802-63470824 GAGAACACAGAAGCTCATCTGGG + Intronic
1177794869 21:25764318-25764340 GAGAAGATAGAAGCTCACCTGGG + Exonic
1178627200 21:34228020-34228042 GAGAACCCCGAGGCTCCTCCAGG + Intergenic
1180675159 22:17581554-17581576 GTGGAGACAGAGGCAGCTCTGGG + Intronic
1181370155 22:22409366-22409388 GAGAAGACACAGGCACCACCTGG + Intergenic
1181439443 22:22928178-22928200 GAGAGGACTGAGGCTCCGATGGG + Intergenic
1181509251 22:23381729-23381751 TAGAAGAGAGATGCCCCTCTGGG - Intergenic
1182618511 22:31604834-31604856 AGGAAGACTGAGGCTGCTCTTGG - Intronic
1184813510 22:46853275-46853297 GGGGTGACAGAGGCACCTCTAGG + Intronic
1185186041 22:49400983-49401005 GAAAACACCGTGGCTCCTCTAGG - Intergenic
949507091 3:4738478-4738500 GAGAAGTCAGAGGCCCCATTCGG + Intronic
950226408 3:11238493-11238515 ATGAAGAAAGAGGCTGCTCTGGG - Intronic
950271512 3:11619765-11619787 CAGCAGACAGAGGCCCCTCTAGG + Intronic
950791707 3:15477279-15477301 GAGGAGACAGTGGGTTCTCTAGG + Intronic
954859366 3:53674810-53674832 GCAGTGACAGAGGCTCCTCTGGG - Intronic
955225485 3:57056892-57056914 CAAAACACAAAGGCTCCTCTTGG + Intronic
955480439 3:59384473-59384495 GAGAAGACTGAGACTCCTTAGGG - Intergenic
958626747 3:96635566-96635588 GAGAAAACAGGGGATCCTTTAGG - Intergenic
961949183 3:130729376-130729398 CAGAAGACAGGGGCCACTCTTGG + Intronic
963072241 3:141313742-141313764 GAGAAGGGACAGGCACCTCTGGG - Intergenic
963161616 3:142156622-142156644 GAGAAGACAAGGGCTCCCATGGG + Intergenic
963231432 3:142911942-142911964 GAGAAAACAAAGGCTCATGTAGG + Intergenic
966673966 3:182564678-182564700 GAGAAGACAGCTGCTTTTCTGGG - Intergenic
968563108 4:1295481-1295503 GAGAGGAAGGAGGCTGCTCTGGG - Intronic
968751987 4:2394968-2394990 AAGAAGACAGAAGCTTCTCCTGG - Intronic
968853410 4:3100511-3100533 GAGAAGACAGTGACCACTCTAGG - Intronic
969227899 4:5811130-5811152 GAGAGGACAGCGGCATCTCTAGG + Exonic
969829641 4:9784171-9784193 GAGAAAACAGAAGCTCCTCAAGG - Intronic
970218801 4:13786202-13786224 GAGAAGACATAGGATACTGTTGG - Intergenic
970495494 4:16620752-16620774 TATAGGACAGAGGCTCCCCTTGG - Intronic
970841400 4:20475355-20475377 GAAAAGACAGAGATTACTCTAGG - Intronic
971199707 4:24500711-24500733 GAAAAGACAGAGGCTCTTCCTGG - Intergenic
971400835 4:26273918-26273940 GAGAAGACACAGACACCTCCAGG - Intronic
971727316 4:30330870-30330892 GAAATGACAGAGGATCCTTTTGG + Intergenic
973739416 4:53904728-53904750 GAGAAGGTAGAGGCTGCTCTAGG + Intronic
975735726 4:77379028-77379050 GAGAAGCCAGAGTCAGCTCTTGG + Intronic
976373558 4:84318498-84318520 GAGAAAACTGAGGCTCCAATAGG - Intergenic
978852867 4:113358723-113358745 CAGAAGACAGTGGCTCCTCAGGG + Exonic
980835858 4:138191400-138191422 GAGAAGACAGAGAGACCTGTAGG + Intronic
982062167 4:151615577-151615599 GTGTTGACAGAGGCTCATCTGGG + Intronic
984835178 4:184012736-184012758 GAGGTGTCAGAGGCTCCTCGAGG - Intronic
985907982 5:2856251-2856273 GGGAAGAATGAGGCTTCTCTTGG - Intergenic
986032447 5:3906784-3906806 GAGTGAACAGAAGCTCCTCTAGG + Intergenic
986059117 5:4171331-4171353 GGGAAGACAGAGGATGGTCTAGG + Intergenic
986769058 5:10955487-10955509 CAGAAGAAAGAGGCACCTCTGGG - Intergenic
987088292 5:14488835-14488857 TGGAAGACAGAGACTGCTCTGGG + Intronic
992465350 5:76998863-76998885 GTGGAGGCAGAGGTTCCTCTTGG + Intergenic
995156627 5:108922063-108922085 GAGAAGACAGAGGCAGATATTGG + Intronic
995617345 5:113979898-113979920 GAGAGGACAGAGACCACTCTAGG - Intergenic
997265574 5:132493247-132493269 CAGAACACATAGGCTCCTGTAGG + Intergenic
998331525 5:141332080-141332102 GAGAAGATGGAGGCTCCTCTGGG - Exonic
998332366 5:141340367-141340389 GAGAAGACAGAGGCTCCTCTGGG - Exonic
998332917 5:141345429-141345451 GAGAAGATGGAGGCTCCTCTGGG - Exonic
998334222 5:141356596-141356618 GATAAGATGGAGGCTCCTCTGGG - Exonic
998335234 5:141365726-141365748 GAGAAGATAGAGACACCTCTGGG - Exonic
998336319 5:141375479-141375501 GAGAAGATGGAGGCACCCCTGGG - Exonic
998341595 5:141422626-141422648 GAGAAGATGGAGGCACCCCTGGG - Exonic
999079726 5:148831685-148831707 GAGAAGACGGAGACTGCTGTGGG + Intergenic
999197650 5:149793377-149793399 CAGAAGACAGAGGATGCTCTGGG - Intronic
999202350 5:149825301-149825323 GAGGACACAGAGGCTCCTGGAGG - Intronic
999481805 5:151955443-151955465 GAGGAGACGCAAGCTCCTCTGGG + Intergenic
999678671 5:154033838-154033860 GAGAAGGCAGAGACTTCCCTTGG - Exonic
1001593810 5:172885065-172885087 TGGAAGTCAGAGGCTGCTCTGGG - Intronic
1001925182 5:175630987-175631009 GAGAAGAAGGAGGCTAGTCTTGG + Intergenic
1003605229 6:7553810-7553832 AAGAAGACACAGGCTCCTCCAGG - Intronic
1003868846 6:10385894-10385916 GAGCAAACACAGGCTCCCCTTGG - Intergenic
1004513561 6:16302903-16302925 GCGGTGACAGAGGCTGCTCTGGG + Exonic
1007265410 6:40591917-40591939 GAGAAGGCAGAGTTTCCTCCTGG + Intergenic
1009688450 6:66993620-66993642 GAGAACACAGAGGATGCTCATGG - Intergenic
1010171015 6:72975528-72975550 GAGAAGACAGATGTTTCTCTAGG - Intronic
1014081268 6:117288658-117288680 GAAAAGTCTGAGGGTCCTCTAGG - Exonic
1018374612 6:163199357-163199379 GCTAGGACAGAGGCTCCTCCAGG + Intronic
1018551077 6:164999533-164999555 GAGAAGACAGAGATGGCTCTGGG + Intergenic
1018750072 6:166796646-166796668 GAGAGGAGAGAGGCTCCAATGGG - Intronic
1019139336 6:169933785-169933807 GTTAAGCGAGAGGCTCCTCTGGG - Intergenic
1019553500 7:1616925-1616947 GAGGAAACAGAGGCTCCTCAAGG - Intergenic
1019624650 7:2009777-2009799 GAGAGGACAGAGCCTGCCCTGGG + Intronic
1019633848 7:2064948-2064970 GGGAGGACAGAGGCTTCTCCCGG + Intronic
1019672442 7:2288680-2288702 GAGAAGTCAGTGGTTACTCTTGG - Intronic
1021543714 7:21789700-21789722 GAGAAAACAGAGGCTCATAGAGG - Intronic
1022979846 7:35594104-35594126 GAGACGCCGGAGTCTCCTCTAGG - Intergenic
1027891751 7:83986602-83986624 GAGAAGACAGAGACTGCTTGTGG + Intronic
1029706649 7:102279950-102279972 GAGGAAACTGAGGCTCCCCTGGG + Intronic
1033035375 7:137871268-137871290 GAGAACACATGGGCTCCTCATGG + Intergenic
1036638550 8:10567745-10567767 GACATGAGACAGGCTCCTCTGGG + Intergenic
1037362213 8:18085000-18085022 GAGACGTCAGAGGCTCATCCAGG - Intergenic
1037434824 8:18851441-18851463 GAGGAGACAGAGCCTGCTTTGGG - Intronic
1038736427 8:30173923-30173945 GAGAAAACATAGCCTCCTTTAGG - Intronic
1039508909 8:38073116-38073138 GAGAAGATGGAAGTTCCTCTGGG - Intergenic
1040392702 8:46963108-46963130 GAGAAGACAGAGGCTTACCCGGG - Intergenic
1040542846 8:48375307-48375329 GAGAAAGCAGAGGCTCCCCCAGG + Intergenic
1040636103 8:49274814-49274836 GAGGAAACAGAGTCTCCCCTGGG + Intergenic
1041363508 8:57076204-57076226 GAGAAGAGAGACTCTCCTTTAGG + Intergenic
1043151816 8:76727225-76727247 CAGCAGAAAGAGGCTCCTTTTGG - Intronic
1043406122 8:79935282-79935304 GAGCACACAGATGTTCCTCTTGG - Intronic
1043865134 8:85365893-85365915 CAGAGGGCAGTGGCTCCTCTAGG + Intronic
1044946652 8:97395915-97395937 GAGAAGTGAGAGGCTGATCTAGG - Intergenic
1045891960 8:107168117-107168139 GAAATGACAGAAGCTACTCTAGG + Intergenic
1047436002 8:124835846-124835868 GAGAAGGGAGTGGCTCCACTTGG + Intergenic
1048801356 8:138197312-138197334 GAGAAGACACATGTTCCTCAAGG - Intronic
1048999310 8:139814510-139814532 CAGAGTTCAGAGGCTCCTCTGGG + Intronic
1049053344 8:140216129-140216151 GAGAAAACTGAGGCTCCTTGAGG - Intronic
1049204812 8:141358804-141358826 AAGGAGACAGAGGCCCCTGTGGG + Intronic
1049651237 8:143771004-143771026 GAGAGGACAGAGCTCCCTCTGGG + Intergenic
1049884744 9:19420-19442 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
1049884763 9:19490-19512 GAGAAGGCAGAGGCGCGACTGGG + Intergenic
1050642779 9:7686051-7686073 GATAAGACAGAGGTACATCTAGG + Intergenic
1051896866 9:21996157-21996179 GAGAAGTCTGCCGCTCCTCTAGG - Intronic
1052358126 9:27527602-27527624 GGGAAGAAAGAGGCTTCTGTAGG - Intronic
1053574159 9:39341458-39341480 GAGAAGACAGATCATCCTTTAGG + Intergenic
1053625246 9:39863877-39863899 GAGAAGACAGATCATCCTTTAGG + Intergenic
1053838719 9:42169704-42169726 GAGAAGACAGATCATCCTTTAGG + Intergenic
1053879622 9:42579349-42579371 GAGAAGACAGATCATCCTTTAGG - Intergenic
1054095723 9:60900150-60900172 GAGAAGACAGATCATCCTTTAGG + Intergenic
1054117184 9:61176089-61176111 GAGAAGACAGATCATCCTTTAGG + Intergenic
1054218645 9:62386817-62386839 GAGAAGACAGATCATCCTTTAGG - Intergenic
1054232070 9:62522350-62522372 GAGAAGACAGATCATCCTTTAGG + Intergenic
1054590573 9:67006479-67006501 GAGAAGACAGATCATCCTTTAGG - Intergenic
1054813043 9:69449916-69449938 GAGAAGACAGGAACTCATCTGGG - Intronic
1055693489 9:78858397-78858419 GAGAAGAAAGAGGGTCCAATTGG - Intergenic
1056760477 9:89411105-89411127 GAGCAGGCAGAGGCTCCAATGGG + Intronic
1059018004 9:110543188-110543210 ACAAAGACAGAGGCACCTCTTGG + Intronic
1059888644 9:118775956-118775978 GAGAAGAAAGGTGATCCTCTTGG - Intergenic
1060300572 9:122372340-122372362 GAGAGGACGGAGGGTGCTCTAGG + Intronic
1061259789 9:129473745-129473767 GAGAAGAAGGATGCTTCTCTAGG + Intergenic
1061330709 9:129890484-129890506 AAGCAGACGGAGGCTCCTCCAGG + Exonic
1061394201 9:130334357-130334379 GAGCAGACACAGGCTCTGCTGGG + Intronic
1061887293 9:133598220-133598242 GAGGAGACAGCAGCTCCTCAGGG + Intergenic
1062039118 9:134396104-134396126 GGGGAGACTGAGGCTCATCTAGG + Intronic
1062173380 9:135147731-135147753 GAGAAAGCAGAGGCTCCACATGG + Intergenic
1062293974 9:135813939-135813961 GAGAAGACAGAGGCGGGGCTAGG - Intronic
1185612967 X:1403009-1403031 GAGGAGACAGAGGCTGCATTTGG - Intergenic
1185612981 X:1403063-1403085 GAGGAGACAGAGGCTGCATTTGG - Intergenic
1186356636 X:8798904-8798926 GAGCAGACAGACCGTCCTCTTGG + Intronic
1187505574 X:19875689-19875711 GAGGAGACAGAAGCTCCGGTGGG + Intronic
1187842062 X:23499206-23499228 GAGAAGACAAAAGCTCCTTATGG - Intergenic
1188397216 X:29700046-29700068 GAGAAAACAGAGGCACCAATGGG - Intronic
1190301387 X:49059416-49059438 GGGAGGACAGAGGCTACTCCTGG - Intronic
1190571245 X:51784416-51784438 GAGAAGACAGAGGATAGACTTGG - Intergenic
1190863288 X:54363532-54363554 GAGAGAACAGAGGCTGTTCTAGG - Intergenic
1191898496 X:66018002-66018024 GAGATAACAAAGGCTCCTGTTGG - Intergenic
1200401045 X:156020662-156020684 GAGAAGGCAGAGGCGCGACTGGG - Intergenic
1201951811 Y:19573569-19573591 GACAAAACAGATTCTCCTCTGGG + Intergenic