ID: 998332755

View in Genome Browser
Species Human (GRCh38)
Location 5:141344148-141344170
Sequence CTAGATAAAGGTTCCTTCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998332750_998332755 9 Left 998332750 5:141344116-141344138 CCGGTCAGATCCGCTACTCGGTG 0: 1
1: 0
2: 2
3: 2
4: 59
Right 998332755 5:141344148-141344170 CTAGATAAAGGTTCCTTCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 46
998332752_998332755 -1 Left 998332752 5:141344126-141344148 CCGCTACTCGGTGTCTGAGGAGC 0: 1
1: 0
2: 0
3: 20
4: 99
Right 998332755 5:141344148-141344170 CTAGATAAAGGTTCCTTCGTGGG 0: 1
1: 0
2: 0
3: 7
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998332755 Original CRISPR CTAGATAAAGGTTCCTTCGT GGG Exonic
904934180 1:34115474-34115496 CTAGATAAAGGATTCTTGGTTGG - Intronic
906328576 1:44865477-44865499 ATAGATAAAGCTTCCTTCTGTGG + Intronic
908704556 1:66937166-66937188 CTAGATCAAGGTTCCATGGTAGG - Intronic
909879119 1:80850091-80850113 CTAGATAAAGATTTATACGTTGG + Intergenic
914319481 1:146545282-146545304 CTAGAAAAAGGTTCCCCCTTTGG + Intergenic
1071367791 10:84917646-84917668 CTAGGCAAAGGTTCCCTGGTGGG + Intergenic
1089691889 11:120192002-120192024 CAAGAGAAAGGTTCCTGGGTGGG + Intergenic
1095473063 12:42556952-42556974 CAAAATAAAGGTTCATTCCTTGG - Intronic
1096085496 12:48862762-48862784 CTAGAGCAAGAGTCCTTCGTTGG + Intronic
1100349832 12:93769882-93769904 CTAGATGTAAGTTCCTTTGTTGG + Intronic
1126271547 15:46824578-46824600 ATAGAGAAAGATTGCTTCGTGGG - Intergenic
1127401126 15:58586826-58586848 CTAGATAAATGTTAGTTCCTAGG - Intergenic
1127834472 15:62779554-62779576 CTAGTTAAAGGTTCTTTGGCTGG + Intronic
1130178106 15:81596008-81596030 CTAGAAAAAGGTCACTTCTTTGG + Intergenic
1130183839 15:81659446-81659468 CTGAATAAAGGCTCCTTCTTTGG + Intergenic
1130188143 15:81705314-81705336 CTGAATAAAGGCTCCTTCTTTGG + Intergenic
1140014042 16:71164799-71164821 CTAGAAAAAGGTTCCCCCTTTGG - Intronic
1153290486 18:3497333-3497355 CTAGTTAAAAGTTGGTTCGTTGG + Exonic
932502484 2:72195538-72195560 CTTGTTAAAGGTTCCTAGGTGGG + Intronic
940839196 2:158559495-158559517 CTAGGTCAGGGTTCCTGCGTAGG - Intronic
946454249 2:219811067-219811089 CTAGATAAAGTATTCTTTGTTGG + Intergenic
946586729 2:221197280-221197302 CTAGATAAACATTGCTGCGTTGG - Intergenic
948721400 2:239903205-239903227 CTAGAGAAATGTTCCTCAGTGGG - Intronic
1173277511 20:41597542-41597564 CTAGATAAGGGGTCCTTCCCAGG - Intronic
1178507109 21:33171307-33171329 CCATATAAAGGTCCCTTTGTCGG + Intergenic
1185317237 22:50184471-50184493 CTCGCTGAAGGTTCCTGCGTGGG + Intergenic
951580142 3:24154070-24154092 TTAGAAAAATGTTCCTTCTTGGG + Intronic
959983583 3:112547040-112547062 CCAGGTAAAAGTTCCTTCTTAGG - Intronic
966570406 3:181435846-181435868 CTAAATATAGGTTCTATCGTTGG - Intergenic
966669570 3:182512009-182512031 TTAGAGAAAGGTTTCTTCATGGG + Intergenic
972350392 4:38231231-38231253 CTTGAGAAAGGTTCCTTCCGGGG - Intergenic
972616996 4:40708745-40708767 CTAGATGCAGGTTCCTTATTGGG - Intergenic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
985301561 4:188495590-188495612 CTGGATAAAAGTTCTTTCTTAGG + Intergenic
991908206 5:71533985-71534007 CTAGATAAAAGTTGCTTAGCAGG + Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
998331367 5:141330799-141330821 ACAGACAAAGGTTCCTTCGTAGG + Exonic
998332755 5:141344148-141344170 CTAGATAAAGGTTCCTTCGTGGG + Exonic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
998340470 5:141413302-141413324 TTAGAGAAAGGCTCTTTCGTGGG + Exonic
1004949509 6:20652868-20652890 CAAGATAAAGGTTACTTCTTGGG - Intronic
1017105350 6:150882687-150882709 TTATATAAAGCTTCCTTTGTTGG + Intronic
1017559186 6:155608162-155608184 ATAGATAAATGTTCATTGGTTGG + Intergenic
1019753957 7:2754368-2754390 CTAGATAATGAGTCCTTTGTCGG + Intronic
1024210302 7:47197555-47197577 CAAGATAAAGGTGCCATCGTTGG - Intergenic
1035915951 8:3622562-3622584 CTAAAAAAAGGTTACTTAGTTGG + Intronic
1037211746 8:16396611-16396633 CTAGCTAAAATTTCCTTGGTGGG - Intronic
1039823929 8:41157173-41157195 CTGCATAAAGATTCCTTGGTGGG + Intergenic
1043797021 8:84555441-84555463 CTACATAAATGTTCATTCTTGGG + Intronic
1048765032 8:137834452-137834474 CCAGGTAGAGGTTCCTTCCTGGG + Intergenic
1186943919 X:14543400-14543422 CTAGATAATGTTTCCTTTCTTGG + Intronic
1195724664 X:107902158-107902180 GTAGATAAAGGTACCTACCTCGG + Intronic
1201580302 Y:15504128-15504150 CTAGATAAATATTCATTAGTGGG + Intergenic