ID: 998334076

View in Genome Browser
Species Human (GRCh38)
Location 5:141355428-141355450
Sequence AGGTGCCGCTGCGCGGGTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998334076_998334081 -10 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334081 5:141355441-141355463 AGCGGCACCTTGGTCACCGCGGG 0: 2
1: 1
2: 5
3: 4
4: 51
998334076_998334087 7 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334087 5:141355458-141355480 CGCGGGTAGGATAGACAGGGAGG 0: 1
1: 1
2: 3
3: 32
4: 122
998334076_998334085 4 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334085 5:141355455-141355477 CACCGCGGGTAGGATAGACAGGG 0: 1
1: 1
2: 2
3: 8
4: 19
998334076_998334084 3 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334084 5:141355454-141355476 TCACCGCGGGTAGGATAGACAGG 0: 2
1: 2
2: 5
3: 2
4: 25
998334076_998334082 -6 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334082 5:141355445-141355467 GCACCTTGGTCACCGCGGGTAGG 0: 2
1: 1
2: 1
3: 9
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998334076 Original CRISPR AGGTGCCGCTGCGCGGGTTC AGG (reversed) Exonic
900447472 1:2688544-2688566 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
900450324 1:2746324-2746346 GGGTGCTGCTCCGTGGGTTCAGG - Intronic
905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG + Exonic
907190290 1:52642273-52642295 TGGTGCTGCTGAGCGGGGTCAGG + Intronic
912481499 1:109985069-109985091 CGATGCCGCTGCCCGGGGTCGGG + Exonic
913222080 1:116667720-116667742 AGGGGCCGCAGCGCGGCTGCTGG - Exonic
918208282 1:182328715-182328737 AGCTGCGGCTGTGTGGGTTCAGG + Intergenic
918302467 1:183216607-183216629 AGGAGGCGCTGCACGGCTTCGGG - Intronic
920017712 1:202927096-202927118 CGGTGCGGCTGTGTGGGTTCGGG - Exonic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1068168066 10:53357193-53357215 AGGTGCAGCTCAGAGGGTTCTGG + Intergenic
1071970999 10:90906679-90906701 AGGTGCCTCTGCCCTAGTTCAGG - Intronic
1075645479 10:124093368-124093390 CGGCGCCCCTCCGCGGGTTCGGG - Intronic
1077155299 11:1088416-1088438 AGGAGCGGCGGTGCGGGTTCAGG - Intergenic
1091226051 11:133956941-133956963 AGGTGCCGCTGCGCCGGGGCCGG - Exonic
1091697292 12:2636451-2636473 AGGAGCTGCTGGACGGGTTCAGG - Intronic
1092767840 12:11869540-11869562 AGGGGCCGCTGCTCGGGGTCAGG - Exonic
1095945130 12:47749369-47749391 AGGTGCTGCTGCTGGGGTTGGGG - Exonic
1102035165 12:109766793-109766815 AGATGCCCCTGCCCGGCTTCGGG - Intronic
1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG + Exonic
1105278078 13:18947792-18947814 AGGTGCAGCTGTGCCTGTTCAGG - Intergenic
1124190710 15:27574257-27574279 AGGTGGCGCTGCGGCGGGTCGGG + Intergenic
1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG + Intergenic
1131215304 15:90530554-90530576 GGGTGGCGCGGCGCGGCTTCTGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1151314126 17:73311543-73311565 GGGTGCCGCTGAGGGGGTTGGGG - Intronic
1151498860 17:74476012-74476034 AGGTGCCGCAGGGAGGGTGCAGG - Intronic
1152321471 17:79610624-79610646 AGGGGTCCCTGCGCGGGGTCGGG - Intergenic
1168591044 19:57634315-57634337 AGGTGAGGCTGAGCTGGTTCAGG + Intronic
1168648968 19:58080683-58080705 AGGGGCAGCTGGGCTGGTTCAGG - Intronic
930780807 2:55223672-55223694 AGGGACCGCTGAGCGGGTCCGGG - Intronic
932568541 2:72924541-72924563 AGGTGAGGGTGCGCGGGTGCAGG + Intronic
936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG + Exonic
936183635 2:110286912-110286934 AGGTGGCGCAGCGCGGTTCCTGG - Intergenic
937672574 2:124553955-124553977 AGGTGCCGATGGGAGTGTTCTGG + Intronic
938380344 2:130832859-130832881 AGGTGCCCCTGCCCTGGCTCTGG + Intergenic
946416664 2:219543442-219543464 AGGTGACGCTGAGCAGGCTCAGG + Exonic
1181256849 22:21568159-21568181 CGGTTCCGCGGCGCGGGCTCCGG - Intronic
1182076349 22:27498064-27498086 AGGGGCCACTGCGCAGCTTCAGG - Intergenic
951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG + Exonic
954036651 3:47854492-47854514 GGCTGCTGCTGCTCGGGTTCAGG - Intronic
967883159 3:194315687-194315709 AGGTGCCGATGCACGGGGGCGGG + Intergenic
968046163 3:195624866-195624888 AGGAGCCGCTGTGCGCGTTCAGG + Intergenic
968064721 3:195752320-195752342 AGGGGGCGCTTGGCGGGTTCAGG - Intronic
968114796 3:196081567-196081589 AGGTGCAGCTGCGCGGCGTGCGG - Intronic
968308491 3:197665221-197665243 AGGAGCCGCTGTGCGCGTTCAGG - Intergenic
968698129 4:2042487-2042509 AGGTGCCGGGGGCCGGGTTCCGG + Intronic
968955916 4:3719353-3719375 AGGCCCCGCTGGGTGGGTTCGGG - Intergenic
981713602 4:147732208-147732230 AGGTGCGGCGCCGCGCGTTCAGG - Exonic
985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG + Intergenic
985747148 5:1654009-1654031 AGGAGCCGCTGTGCGCGTTCAGG - Intergenic
998095614 5:139394271-139394293 AGGTGGCGCTGCTCGGGGCCGGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
998341411 5:141421289-141421311 TGGGGACGCTGCGGGGGTTCCGG + Exonic
998342528 5:141430987-141431009 AGCTGCCGCTGCGCGGATTCAGG - Exonic
1006271076 6:32968315-32968337 AGGTGCGGCTTCGCTGGTCCTGG - Intronic
1019744064 7:2689655-2689677 AGGTGCCACTGCGGTGTTTCAGG - Intronic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1021162967 7:17298814-17298836 AGGTGCCGCCGCGCTGCTCCCGG - Exonic
1021868185 7:24979582-24979604 AGGGGCCGCGGCGCAGGTGCGGG - Intronic
1024326613 7:48114231-48114253 AGGTGCCTCTGCAGGGCTTCTGG - Intergenic
1024482857 7:49883210-49883232 AGGTTCCGCTTGGCAGGTTCGGG - Intronic
1029149918 7:98472551-98472573 AGGAGCAGCTGCGGGGGCTCTGG + Intergenic
1034589553 7:152128222-152128244 AGGCGCCCCTGGGCAGGTTCTGG - Intergenic
1035066343 7:156107937-156107959 AAGTGCCGCTGTGTGGCTTCTGG + Intergenic
1038425466 8:27461510-27461532 AGGTGCCTCTCCGCGGAGTCTGG - Exonic
1039441063 8:37595602-37595624 AGGTGCCCCTGCTAGGGATCGGG + Intergenic
1057646182 9:96877329-96877351 AGATGCCGCTGCGCAGGGACAGG + Intergenic
1057699202 9:97350468-97350490 AGGTGTCCCTGCGCAGCTTCCGG + Exonic
1061559554 9:131393975-131393997 AGGGGGCGCTGCGCGGGCCCAGG + Intergenic
1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG + Intronic
1197723450 X:129760353-129760375 ATGTGTGGCTGCCCGGGTTCTGG - Intronic
1197782642 X:130172607-130172629 AGGTGCCGCTGCTCGGGGTAGGG - Intronic