ID: 998334081

View in Genome Browser
Species Human (GRCh38)
Location 5:141355441-141355463
Sequence AGCGGCACCTTGGTCACCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 2, 1: 1, 2: 5, 3: 4, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998334073_998334081 15 Left 998334073 5:141355403-141355425 CCAGAGGTAGGACGCAGCTTTTC 0: 5
1: 2
2: 2
3: 6
4: 100
Right 998334081 5:141355441-141355463 AGCGGCACCTTGGTCACCGCGGG 0: 2
1: 1
2: 5
3: 4
4: 51
998334076_998334081 -10 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334081 5:141355441-141355463 AGCGGCACCTTGGTCACCGCGGG 0: 2
1: 1
2: 5
3: 4
4: 51
998334075_998334081 -9 Left 998334075 5:141355427-141355449 CCCTGAACCCGCGCAGCGGCACC 0: 1
1: 0
2: 3
3: 5
4: 59
Right 998334081 5:141355441-141355463 AGCGGCACCTTGGTCACCGCGGG 0: 2
1: 1
2: 5
3: 4
4: 51
998334072_998334081 26 Left 998334072 5:141355392-141355414 CCGCATCGTCTCCAGAGGTAGGA 0: 5
1: 5
2: 2
3: 5
4: 121
Right 998334081 5:141355441-141355463 AGCGGCACCTTGGTCACCGCGGG 0: 2
1: 1
2: 5
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998334081 Original CRISPR AGCGGCACCTTGGTCACCGC GGG Exonic
916100155 1:161387702-161387724 AGCTGCACCTTGCTCAGCACAGG - Intergenic
922829685 1:228545687-228545709 AGAGGCACCTGGGTGACCCCAGG - Intergenic
922829788 1:228546314-228546336 AGAGGCACCTGGGTGACCACAGG - Intergenic
922830127 1:228548475-228548497 AGGGACACCTTGGTGACCCCAGG - Intergenic
1066212823 10:33256773-33256795 AGTGGCACCTTGGTACCCACTGG + Intronic
1072270760 10:93774135-93774157 AGAGACCCCTTGGTCACCACAGG + Intronic
1083289153 11:61680313-61680335 ACCGTCGCCATGGTCACCGCTGG + Intergenic
1085393605 11:76194930-76194952 GGCGTCACCTTGGTTACAGCAGG - Intronic
1087290758 11:96317703-96317725 AGCAGCTCCTTGGTCAGTGCTGG + Intronic
1094489749 12:30952267-30952289 AGCGTCTCCTGGGCCACCGCAGG - Intronic
1102278295 12:111599218-111599240 GGCGGCTCCTTGGTCTCGGCGGG - Exonic
1105013875 12:132774190-132774212 AGGGGCTCCTTGCTCACGGCGGG + Exonic
1134311911 16:13082858-13082880 ATTTGCACCTTGGTCACCTCTGG - Intronic
1137048237 16:35687659-35687681 AGAGACACCTTGGTGACCTCAGG - Intergenic
1137596162 16:49725416-49725438 AGCGTCACCTTGGACACCAAAGG + Intronic
1141900655 16:86988328-86988350 AGCAGGACCTTGTTCACCCCTGG + Intergenic
1147615425 17:41824550-41824572 AGTGGCACCTGGGACACCGCAGG + Intergenic
1148122776 17:45222331-45222353 AGCGGCACCTGAGTCCCCGGGGG - Intronic
1151591281 17:75046695-75046717 AGCGGCGCCTGGGACACAGCCGG + Intronic
1151819509 17:76490040-76490062 AGCAGCCCCTTGGGCACCGCTGG - Intronic
1152094338 17:78264251-78264273 AGAGGCACCCTGGGCACCCCAGG + Intergenic
1152563920 17:81091788-81091810 AGGGGCAGCTTGGGAACCGCAGG - Intronic
1153177576 18:2395631-2395653 AGCAGCACCTTGCACACCACAGG + Intergenic
1162525446 19:11203805-11203827 AGGGCCAGCTTGGTCACTGCAGG - Intronic
1162803345 19:13123167-13123189 AGCGGCACCAGGGTCACCTCAGG + Intronic
1164372045 19:27651653-27651675 AGAGGCACCTGGGTGACCCCAGG - Intergenic
1164374967 19:27676423-27676445 AGAGGCACCTGGGTGACCCCAGG - Intergenic
1165080797 19:33304884-33304906 AGCGCCACCTTGTTCAGGGCAGG - Intergenic
1167258382 19:48443956-48443978 ACCGCCCCCTTGGTCAGCGCAGG + Exonic
932654911 2:73601994-73602016 AGCTGCAGCTTGGAAACCGCAGG - Intronic
941996077 2:171603192-171603214 AGAGGCACCTGGGTCACTGTCGG + Intergenic
942139659 2:172965289-172965311 AGCGGCCCCCTGGTCTCCCCTGG + Intronic
948525598 2:238569088-238569110 ACCGGCACCGTGGGCACCACTGG - Intergenic
948657377 2:239485082-239485104 AGCGTCGCCTTGTTCACCGATGG - Intergenic
1169691360 20:8335955-8335977 AGAGGCACGTTGATCACAGCAGG + Intronic
1172183873 20:33019607-33019629 AGCCGCACCTTGAGCACCACAGG - Exonic
1175981301 20:62740015-62740037 AGCTCCTCCTTGGTCACAGCTGG + Intronic
1179914586 21:44467889-44467911 AGCGGGACCCAGGTCTCCGCAGG + Intergenic
1180091984 21:45537982-45538004 AGCGTCACCTTCGTCCCCTCCGG - Exonic
986232489 5:5879340-5879362 AGCTGCACCTTGGTGGCTGCTGG - Intergenic
986668598 5:10124495-10124517 AGCTGCAGCTTGCTCACTGCCGG - Intergenic
994189661 5:96855670-96855692 AGCGGAACTTTGGCCACCGTTGG + Intronic
997228310 5:132226091-132226113 GGCTGCACCTTGGACACCTCAGG + Intronic
998334081 5:141355441-141355463 AGCGGCACCTTGGTCACCGCGGG + Exonic
998335087 5:141364571-141364593 AGCGGCAGCTTGGTCACCGCGGG + Exonic
998336171 5:141374324-141374346 AACGGCAGCTTGGTCACCGCGGG + Exonic
998337121 5:141383140-141383162 AGCGGCAGCTTGGTCACTGCGGG + Exonic
998338196 5:141393054-141393076 AGCGGCAGCTTGATCACCGCGGG + Exonic
998339331 5:141403193-141403215 AGCGGCACCTTGGTCACCGCGGG + Exonic
998340492 5:141413428-141413450 AGCGGCAGCTTGATCACCGCGGG + Exonic
998341446 5:141421471-141421493 AGCGGCAGCTTGATCACGGCAGG + Exonic
998342533 5:141431000-141431022 AGCGGCAGCTTGGTCACGGCGGG + Exonic
1021668647 7:23013568-23013590 GGCGGCACCCGGGTCACAGCAGG + Intronic
1034991043 7:155548410-155548432 AGCAGTAACATGGTCACCGCCGG - Intergenic
1035266023 7:157690735-157690757 CGCGGCACCTTTGTCTCCTCCGG - Intronic
1045523747 8:102926009-102926031 AGCAGCTCCTTGGTCACTGGGGG - Intronic
1057612212 9:96555164-96555186 AGGGGCACCCTGTTCACCGTGGG - Intronic
1057692176 9:97295064-97295086 AGCGGAACCTGGGGCACCTCAGG - Intergenic
1061326552 9:129868062-129868084 AGCGCCACCGTGGCCACCACCGG - Exonic
1062298727 9:135851163-135851185 AGCTGCACCGTGCTCTCCGCAGG - Intronic
1062439596 9:136563784-136563806 AGCGGCTCCTGGCTCAGCGCAGG - Intergenic
1191235329 X:58129371-58129393 AGAGGCACCTGGGTGACCTCAGG + Intergenic
1200375387 X:155774633-155774655 AGCGGCAGCCTGGTCGCCGGAGG - Exonic