ID: 998334082

View in Genome Browser
Species Human (GRCh38)
Location 5:141355445-141355467
Sequence GCACCTTGGTCACCGCGGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 2, 1: 1, 2: 1, 3: 9, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998334076_998334082 -6 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334082 5:141355445-141355467 GCACCTTGGTCACCGCGGGTAGG 0: 2
1: 1
2: 1
3: 9
4: 41
998334073_998334082 19 Left 998334073 5:141355403-141355425 CCAGAGGTAGGACGCAGCTTTTC 0: 5
1: 2
2: 2
3: 6
4: 100
Right 998334082 5:141355445-141355467 GCACCTTGGTCACCGCGGGTAGG 0: 2
1: 1
2: 1
3: 9
4: 41
998334072_998334082 30 Left 998334072 5:141355392-141355414 CCGCATCGTCTCCAGAGGTAGGA 0: 5
1: 5
2: 2
3: 5
4: 121
Right 998334082 5:141355445-141355467 GCACCTTGGTCACCGCGGGTAGG 0: 2
1: 1
2: 1
3: 9
4: 41
998334075_998334082 -5 Left 998334075 5:141355427-141355449 CCCTGAACCCGCGCAGCGGCACC 0: 1
1: 0
2: 3
3: 5
4: 59
Right 998334082 5:141355445-141355467 GCACCTTGGTCACCGCGGGTAGG 0: 2
1: 1
2: 1
3: 9
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998334082 Original CRISPR GCACCTTGGTCACCGCGGGT AGG Exonic
909693399 1:78436418-78436440 GCACCCTGGTCAGCCCCGGTGGG + Intronic
920527700 1:206679954-206679976 GCACCAAGGGCACCGTGGGTGGG + Intronic
922125109 1:222713539-222713561 GCACCCTTGTCCCTGCGGGTGGG + Intronic
1065637659 10:27746535-27746557 GCACTTGGGCCACCGCGGGTTGG - Intergenic
1076706689 10:132306161-132306183 GCACCGTGCTCTCCGGGGGTGGG - Intronic
1077405639 11:2381342-2381364 GCACCCTGGTGACCGCAGGGAGG - Intronic
1077425915 11:2477366-2477388 GAACCTAGGTCACCGTGGGCTGG - Intronic
1086174641 11:83875821-83875843 GAACCTTGGTCACCACAGGTGGG + Intronic
1090199907 11:124846479-124846501 GCAGCTGGGTCACCCCGGGGAGG - Intergenic
1103949376 12:124542770-124542792 GCTCCTTGTTCACCCCGTGTGGG - Intronic
1104096217 12:125560228-125560250 GCACCTTGGGAGCTGCGGGTGGG + Intronic
1104919602 12:132283659-132283681 GGACCATGGTCACCGAGGCTCGG + Intronic
1127804014 15:62501961-62501983 GCACCTTGGTATCAGTGGGTTGG + Intronic
1133293873 16:4740540-4740562 CCACCTTTGTCACTGCTGGTCGG - Exonic
1134311910 16:13082854-13082876 GCACCTTGGTCACCTCTGGATGG - Intronic
1140714155 16:77706753-77706775 CCACCTTGGTCACCTCGTGCTGG + Intergenic
1144582456 17:16466593-16466615 GCACCTGAGTCACTGCTGGTGGG + Intronic
1146949040 17:36893074-36893096 GCTCCATGGTCACTGTGGGTGGG - Intergenic
1158897934 18:61932769-61932791 GCATATTGGTCACTGCTGGTAGG - Intergenic
1158960961 18:62587391-62587413 GCACCTGCTTCACCGCGGGAGGG + Intronic
1160522029 18:79513301-79513323 GCACCTTGGCCTCCGCGGCCAGG + Intronic
1162472246 19:10879432-10879454 TCACCTTGGCCACAGTGGGTAGG + Intronic
1163546129 19:17942451-17942473 GAACCTTGGACAGGGCGGGTGGG - Intronic
1163795170 19:19333837-19333859 GCACCTTGCTCACCCAGGCTGGG + Intronic
1166781739 19:45346756-45346778 GCACCTGGCTCTCCGCCGGTGGG - Exonic
940543283 2:155049664-155049686 GCACCTTGGGCAGCTGGGGTTGG - Intergenic
947702543 2:232246485-232246507 GCACCTTGGATACCGTGGGCTGG + Intronic
1176063834 20:63183925-63183947 GCATCCTGGTCACAGTGGGTGGG + Intergenic
1181580916 22:23827624-23827646 TCACCTTGGTCCCAGCGGGATGG - Intronic
1182557408 22:31136750-31136772 GCATGTTGGTAACCTCGGGTGGG + Exonic
953794028 3:45969374-45969396 TCCCCTTGGTCACAGCTGGTAGG + Intronic
954213348 3:49110679-49110701 GGACCTTGGTAACTGTGGGTGGG - Intronic
961810216 3:129517810-129517832 GCACCTTGGTCTTCCCGTGTGGG + Intronic
971983504 4:33788123-33788145 GCAACTTGGACAGCGCTGGTTGG - Intergenic
973888509 4:55346575-55346597 GCGCCTTGACCACCGCGGCTCGG - Intronic
998331388 5:141330929-141330951 GCAGCTTGATCACCGCGCGCAGG + Exonic
998332777 5:141344278-141344300 GCAGCTTGGTCACCGCGGAGAGG + Exonic
998334082 5:141355445-141355467 GCACCTTGGTCACCGCGGGTAGG + Exonic
998335088 5:141364575-141364597 GCAGCTTGGTCACCGCGGGCAGG + Exonic
998336172 5:141374328-141374350 GCAGCTTGGTCACCGCGGGTAGG + Exonic
998337122 5:141383144-141383166 GCAGCTTGGTCACTGCGGGCAGG + Exonic
998338197 5:141393058-141393080 GCAGCTTGATCACCGCGGGCAGG + Exonic
998339332 5:141403197-141403219 GCACCTTGGTCACCGCGGGTAGG + Exonic
998340493 5:141413432-141413454 GCAGCTTGATCACCGCGGGCAGG + Exonic
998342534 5:141431004-141431026 GCAGCTTGGTCACGGCGGGCAGG + Exonic
999201133 5:149817032-149817054 GCAGCTTGGTGACCAGGGGTGGG - Intronic
1001028065 5:168240952-168240974 GAAGCTTGGTCACATCGGGTTGG - Intronic
1007322191 6:41035385-41035407 TCACCTTGGTCACTGTGGCTGGG + Intronic
1009985759 6:70779389-70779411 GCAGCTTGGTCCCAGTGGGTGGG + Intronic
1036591336 8:10171578-10171600 GCAACTTGGTCACTGAGGGAAGG - Intronic
1037518520 8:19657863-19657885 GCACCTTGGGCACCCCCGATGGG + Intronic
1057612210 9:96555160-96555182 GCACCCTGTTCACCGTGGGAGGG - Intronic
1061184250 9:129042770-129042792 GCACCTTGGTCAGAGGGGGTCGG + Intronic
1193449631 X:81649746-81649768 ACATCTTGGTCACAGCGGGGTGG - Intergenic