ID: 998334084

View in Genome Browser
Species Human (GRCh38)
Location 5:141355454-141355476
Sequence TCACCGCGGGTAGGATAGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 2, 1: 2, 2: 5, 3: 2, 4: 25}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998334078_998334084 -3 Left 998334078 5:141355434-141355456 CCCGCGCAGCGGCACCTTGGTCA 0: 2
1: 1
2: 4
3: 2
4: 42
Right 998334084 5:141355454-141355476 TCACCGCGGGTAGGATAGACAGG 0: 2
1: 2
2: 5
3: 2
4: 25
998334075_998334084 4 Left 998334075 5:141355427-141355449 CCCTGAACCCGCGCAGCGGCACC 0: 1
1: 0
2: 3
3: 5
4: 59
Right 998334084 5:141355454-141355476 TCACCGCGGGTAGGATAGACAGG 0: 2
1: 2
2: 5
3: 2
4: 25
998334076_998334084 3 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334084 5:141355454-141355476 TCACCGCGGGTAGGATAGACAGG 0: 2
1: 2
2: 5
3: 2
4: 25
998334079_998334084 -4 Left 998334079 5:141355435-141355457 CCGCGCAGCGGCACCTTGGTCAC 0: 2
1: 1
2: 4
3: 7
4: 55
Right 998334084 5:141355454-141355476 TCACCGCGGGTAGGATAGACAGG 0: 2
1: 2
2: 5
3: 2
4: 25
998334073_998334084 28 Left 998334073 5:141355403-141355425 CCAGAGGTAGGACGCAGCTTTTC 0: 5
1: 2
2: 2
3: 6
4: 100
Right 998334084 5:141355454-141355476 TCACCGCGGGTAGGATAGACAGG 0: 2
1: 2
2: 5
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998334084 Original CRISPR TCACCGCGGGTAGGATAGAC AGG Exonic
903139654 1:21331858-21331880 ACACCGCGGGCAGGAAAGAATGG + Intronic
906498984 1:46326731-46326753 TTTCCGCGGGAAGCATAGACAGG + Intergenic
915212543 1:154321271-154321293 TCACTGCGGGAAGGAAAGAAGGG + Intronic
917116141 1:171605651-171605673 TTTCCGCGGGAAGCATAGACTGG - Intergenic
1069642613 10:69965485-69965507 TCACCGAAGGCAGGACAGACAGG + Intergenic
1076443816 10:130498249-130498271 CCACCGCGTGTTGGAAAGACAGG + Intergenic
1083238745 11:61370149-61370171 TGACCTCGGGTAGGGTAGGCAGG + Intergenic
1096547556 12:52351051-52351073 TCAGGGCGGGGAGGCTAGACTGG + Intergenic
1100685807 12:96985252-96985274 TCACCTGGGGTAGCATAAACAGG - Intergenic
1101413780 12:104491293-104491315 TGACCGGGGGTGGGATGGACAGG + Intronic
1111945128 13:94657065-94657087 TCACCGCAGGGAGGCTGGACTGG + Intergenic
1128558277 15:68646460-68646482 CCACTGTGGGTAGGAGAGACTGG - Intronic
1129127434 15:73455069-73455091 TCACAGCGGGTAGGATGGTTCGG - Intronic
1161936000 19:7372645-7372667 TCACAGCGGGTGGGATGGAATGG - Intronic
1164109309 19:22140222-22140244 CCACCGCGGGGAGGACAGAGGGG - Intergenic
1168293578 19:55368755-55368777 GCACAGCTGGTAGGAGAGACTGG - Exonic
941765527 2:169292351-169292373 CCACCGCAGGTCGGATAGTCTGG + Exonic
943363033 2:186944463-186944485 TCACCCCTGGTAGGTTTGACTGG - Intergenic
1184795289 22:46728636-46728658 TCATAGCGGGTGGGAGAGACAGG - Intronic
961781454 3:129323172-129323194 TCACCCCTTGTAGGATAGAGGGG - Intergenic
995613914 5:113940323-113940345 TCACGGCAGGTGGGACAGACCGG - Intergenic
998331389 5:141330938-141330960 TCACCGCGCGCAGGATAGACCGG + Exonic
998332220 5:141339225-141339247 TCACTGCGAACAGGATAGACCGG + Exonic
998332778 5:141344287-141344309 TCACCGCGGAGAGGATAGACCGG + Exonic
998334084 5:141355454-141355476 TCACCGCGGGTAGGATAGACAGG + Exonic
998335089 5:141364584-141364606 TCACCGCGGGCAGGATAGACCGG + Exonic
998337123 5:141383153-141383175 TCACTGCGGGCAGGATAGACCGG + Exonic
998338198 5:141393067-141393089 TCACCGCGGGCAGGATAGATCGG + Exonic
998339334 5:141403206-141403228 TCACCGCGGGTAGGATAGACCGG + Exonic
998340494 5:141413441-141413463 TCACCGCGGGCAGGATAGACCGG + Exonic
998341448 5:141421484-141421506 TCACGGCAGGCAGGATAGACCGG + Exonic
998342535 5:141431013-141431035 TCACGGCGGGCAGGATAGACCGG + Exonic
1006161815 6:32043735-32043757 TCACCACGGGTGAGATGGACTGG - Exonic
1025769902 7:64494987-64495009 TCACCGCGGGGAGGACAGAGGGG - Intergenic
1025941868 7:66081059-66081081 TCACCTGGGGTGGGATAGCCAGG - Intronic
1055400269 9:75916402-75916424 TCACAGTGGGTGGGATAGAGTGG - Intronic