ID: 998334085

View in Genome Browser
Species Human (GRCh38)
Location 5:141355455-141355477
Sequence CACCGCGGGTAGGATAGACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 19}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998334078_998334085 -2 Left 998334078 5:141355434-141355456 CCCGCGCAGCGGCACCTTGGTCA 0: 2
1: 1
2: 4
3: 2
4: 42
Right 998334085 5:141355455-141355477 CACCGCGGGTAGGATAGACAGGG 0: 1
1: 1
2: 2
3: 8
4: 19
998334073_998334085 29 Left 998334073 5:141355403-141355425 CCAGAGGTAGGACGCAGCTTTTC 0: 5
1: 2
2: 2
3: 6
4: 100
Right 998334085 5:141355455-141355477 CACCGCGGGTAGGATAGACAGGG 0: 1
1: 1
2: 2
3: 8
4: 19
998334075_998334085 5 Left 998334075 5:141355427-141355449 CCCTGAACCCGCGCAGCGGCACC 0: 1
1: 0
2: 3
3: 5
4: 59
Right 998334085 5:141355455-141355477 CACCGCGGGTAGGATAGACAGGG 0: 1
1: 1
2: 2
3: 8
4: 19
998334076_998334085 4 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334085 5:141355455-141355477 CACCGCGGGTAGGATAGACAGGG 0: 1
1: 1
2: 2
3: 8
4: 19
998334079_998334085 -3 Left 998334079 5:141355435-141355457 CCGCGCAGCGGCACCTTGGTCAC 0: 2
1: 1
2: 4
3: 7
4: 55
Right 998334085 5:141355455-141355477 CACCGCGGGTAGGATAGACAGGG 0: 1
1: 1
2: 2
3: 8
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998334085 Original CRISPR CACCGCGGGTAGGATAGACA GGG Exonic
902080953 1:13820487-13820509 CCCCTGGGGTAGGAAAGACACGG - Intronic
906498985 1:46326732-46326754 TTCCGCGGGAAGCATAGACAGGG + Intergenic
1076443817 10:130498250-130498272 CACCGCGTGTTGGAAAGACAGGG + Intergenic
1093400153 12:18736181-18736203 CACCTAGGATAGGATAGGCAGGG + Intronic
1100685806 12:96985251-96985273 CACCTGGGGTAGCATAAACAGGG - Intergenic
1101444159 12:104725550-104725572 CACGGCGGGGAGGAGACACAGGG - Intronic
1102429182 12:112868410-112868432 CACCTTGGGGAGGAGAGACAGGG - Exonic
1104177567 12:126347884-126347906 CACCGAGGGCAGGATAGACCAGG - Intergenic
1108581040 13:51828401-51828423 CACAGCGGGTAGGGTGCACAGGG + Intergenic
1121493840 14:94378542-94378564 GACCTCGGGGGGGATAGACATGG + Exonic
1143650870 17:8263743-8263765 CACGGCGGGGAGGAAAGAGAAGG - Intronic
1168293577 19:55368754-55368776 CACAGCTGGTAGGAGAGACTGGG - Exonic
947080100 2:226386576-226386598 CACTGCTGATAGGATACACATGG + Intergenic
954681258 3:52347265-52347287 CACCGAGGGGAGGATAGGCCTGG + Intronic
990514976 5:56522463-56522485 CATCTCGGGTAGAATAGACAAGG + Intronic
997867085 5:137473481-137473503 CACAGTGGGCAGGATAAACAGGG + Intronic
998331390 5:141330939-141330961 CACCGCGCGCAGGATAGACCGGG + Exonic
998332779 5:141344288-141344310 CACCGCGGAGAGGATAGACCGGG + Exonic
998334085 5:141355455-141355477 CACCGCGGGTAGGATAGACAGGG + Exonic
998335090 5:141364585-141364607 CACCGCGGGCAGGATAGACCGGG + Exonic
998337124 5:141383154-141383176 CACTGCGGGCAGGATAGACCGGG + Exonic
998338199 5:141393068-141393090 CACCGCGGGCAGGATAGATCGGG + Exonic
998339335 5:141403207-141403229 CACCGCGGGTAGGATAGACCGGG + Exonic
998340495 5:141413442-141413464 CACCGCGGGCAGGATAGACCGGG + Exonic
998341449 5:141421485-141421507 CACGGCAGGCAGGATAGACCGGG + Exonic
998342536 5:141431014-141431036 CACGGCGGGCAGGATAGACCGGG + Exonic
1003111304 6:3253837-3253859 CACCGCGGGGGTGTTAGACATGG - Intronic
1025022669 7:55492244-55492266 CACTGTGGGGAGGAGAGACAAGG + Intronic
1025941867 7:66081058-66081080 CACCTGGGGTGGGATAGCCAGGG - Intronic
1050062804 9:1728171-1728193 CACAGTGGATAGGATAGATATGG + Intergenic
1050769813 9:9183828-9183850 CAGAACGAGTAGGATAGACAAGG - Intronic