ID: 998334087

View in Genome Browser
Species Human (GRCh38)
Location 5:141355458-141355480
Sequence CGCGGGTAGGATAGACAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998334076_998334087 7 Left 998334076 5:141355428-141355450 CCTGAACCCGCGCAGCGGCACCT 0: 1
1: 0
2: 3
3: 6
4: 65
Right 998334087 5:141355458-141355480 CGCGGGTAGGATAGACAGGGAGG 0: 1
1: 1
2: 3
3: 32
4: 122
998334078_998334087 1 Left 998334078 5:141355434-141355456 CCCGCGCAGCGGCACCTTGGTCA 0: 2
1: 1
2: 4
3: 2
4: 42
Right 998334087 5:141355458-141355480 CGCGGGTAGGATAGACAGGGAGG 0: 1
1: 1
2: 3
3: 32
4: 122
998334075_998334087 8 Left 998334075 5:141355427-141355449 CCCTGAACCCGCGCAGCGGCACC 0: 1
1: 0
2: 3
3: 5
4: 59
Right 998334087 5:141355458-141355480 CGCGGGTAGGATAGACAGGGAGG 0: 1
1: 1
2: 3
3: 32
4: 122
998334079_998334087 0 Left 998334079 5:141355435-141355457 CCGCGCAGCGGCACCTTGGTCAC 0: 2
1: 1
2: 4
3: 7
4: 55
Right 998334087 5:141355458-141355480 CGCGGGTAGGATAGACAGGGAGG 0: 1
1: 1
2: 3
3: 32
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998334087 Original CRISPR CGCGGGTAGGATAGACAGGG AGG Exonic
900076197 1:819927-819949 AGCAGGTAGTATAGACAGGGTGG - Intergenic
900076203 1:819962-819984 CGCAGGTAGTCTAGACAGGGTGG - Intergenic
900076214 1:820032-820054 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076233 1:820172-820194 AGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076242 1:820242-820264 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076248 1:820277-820299 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076254 1:820312-820334 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076261 1:820347-820369 GGCAGGTAGTATAGACAGGGCGG - Intergenic
900076267 1:820382-820404 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076274 1:820417-820439 GGCAGGTAGTGTAGACAGGGCGG - Intergenic
900076295 1:820522-820544 GGCAGGTAGTGTAGACAGGGCGG - Intergenic
900076322 1:820697-820719 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076328 1:820732-820754 GGCAGGTAATATAGACAGGGTGG - Intergenic
900076340 1:820802-820824 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076357 1:820907-820929 AGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076363 1:820942-820964 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076379 1:821047-821069 GGCAGGTAGTATAGACAGGTTGG - Intergenic
900076383 1:821082-821104 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076390 1:821117-821139 CGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076396 1:821152-821174 AGCAGGTAGTGTAGACAGGGCGG - Intergenic
900076423 1:821362-821384 GGCAAGTAGTATAGACAGGGTGG - Intergenic
900076434 1:821432-821454 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076440 1:821467-821489 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076503 1:821883-821905 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076509 1:821918-821940 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076526 1:822023-822045 AGCAGGTAGAGTAGACAGGGTGG - Intergenic
900076532 1:822058-822080 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076542 1:822128-822150 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076548 1:822163-822185 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076553 1:822198-822220 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076568 1:822268-822290 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076590 1:822407-822429 GGGAGGTAGTATAGACAGGGTGG - Intergenic
900076598 1:822442-822464 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076605 1:822477-822499 GTCAGGTAGTATAGACAGGGTGG - Intergenic
900076611 1:822512-822534 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076632 1:822652-822674 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900076642 1:822722-822744 GGCAGTTAGTATAGACAGGGTGG - Intergenic
900076652 1:822792-822814 AGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076666 1:822862-822884 GGCAGGTAGTACAGACAGGGCGG - Intergenic
900076673 1:822897-822919 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076680 1:822932-822954 GGCAGGTAGTATGGACAGGGTGG - Intergenic
900076691 1:823002-823024 GGCAGGTAGTATAGACAGAGTGG - Intergenic
900076722 1:823212-823234 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076729 1:823247-823269 GGCAGGTAGTATAGAAAGGGCGG - Intergenic
900076737 1:823282-823304 GGCCGGTAGTATAGACAGGGCGG - Intergenic
900076743 1:823317-823339 GGCAGGTAGTATAGACAGAGTGG - Intergenic
900076753 1:823387-823409 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076770 1:823492-823514 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076777 1:823527-823549 GGCAGGTAGTGTAGACAGGGTGG - Intergenic
900076789 1:823597-823619 GGCAGGTAGTATAGACAGGGTGG - Intergenic
900307354 1:2017595-2017617 CTCAGGAAGGAAAGACAGGGAGG + Intergenic
908780565 1:67686016-67686038 CGCGTGTAGGATGGATAAGGTGG + Exonic
1064631323 10:17315733-17315755 CGAGGGTGGGATGGACAGGGAGG + Intergenic
1069738996 10:70675568-70675590 CTCTGGGAGGAGAGACAGGGAGG - Intronic
1074263078 10:111873415-111873437 GGCAGGCAGGATAGACAGGGTGG + Intergenic
1083238747 11:61370153-61370175 CTCGGGTAGGGTAGGCAGGCTGG + Intergenic
1089763318 11:120744630-120744652 CACGGGTAGGGTAGAAAGTGTGG + Intronic
1090460372 11:126886381-126886403 CGCTGGTAGGAGATACAGTGGGG - Intronic
1098221460 12:68274494-68274516 AGAGGGTAGGATACACAGAGAGG + Intronic
1100200959 12:92297378-92297400 CTGGGGTAGGGTAGATAGGGTGG - Intergenic
1102614911 12:114145173-114145195 CAGGGGTAGGAAAGAAAGGGAGG - Intergenic
1106697451 13:32192041-32192063 CCTGGGTAGGAAAGACAGGCTGG + Intronic
1112400485 13:99073203-99073225 CAGGGGTAGGATATGCAGGGTGG - Intronic
1118812217 14:69283551-69283573 CCAAGGTAGGATAGACAGGATGG + Intronic
1122125711 14:99577409-99577431 GGTGGGTGGGACAGACAGGGAGG + Intronic
1130767336 15:86884268-86884290 GGCAGGTAGTATACACAGGGTGG + Intronic
1132134717 15:99324181-99324203 GGCGAGGAGGGTAGACAGGGCGG + Intronic
1132647760 16:1006986-1007008 CGCGGACAGGACAGACGGGGTGG - Intergenic
1140602207 16:76490772-76490794 CGAGGGTTGTATAGGCAGGGTGG - Intronic
1148514782 17:48206341-48206363 GGAGGGTAGCATAGCCAGGGAGG - Intronic
1151373435 17:73665614-73665636 CGCGGGAGGGAGAGAGAGGGAGG - Intergenic
1156524424 18:37753202-37753224 GGCGGGTAGGAGACACAGGGAGG + Intergenic
1156785739 18:40912075-40912097 CGTGGGTAGTATAGGCAGTGTGG - Intergenic
1158479474 18:57807496-57807518 TGTGGGTAGGAAAGCCAGGGAGG + Intergenic
1160081087 18:75727725-75727747 GGCATGTAGCATAGACAGGGAGG - Intergenic
1162121690 19:8473841-8473863 CGCTGGAAGGATGGACAGGCAGG - Intronic
1163492072 19:17623023-17623045 CGGGAGTTGGGTAGACAGGGTGG + Intronic
1163794994 19:19332700-19332722 CACGGGTGGGCTAGACAGAGAGG - Intronic
1167582973 19:50357413-50357435 CTCGGGCAGGAGAGTCAGGGAGG - Intronic
926247075 2:11129761-11129783 TGCGGGAAGGAGAGAGAGGGTGG + Intergenic
939749909 2:146031308-146031330 GGCGGGTAGCATAGACAGCATGG + Intergenic
942242775 2:173978621-173978643 GGTGGGTAGGATTGACAGTGTGG + Intergenic
946265791 2:218540225-218540247 GGCGGGTAGCATATACAGTGTGG + Intronic
1169347379 20:4839307-4839329 CTAGGGTGGGATTGACAGGGGGG + Intergenic
1173118444 20:40268687-40268709 CAAGGGTTTGATAGACAGGGAGG + Intergenic
1180353373 22:11821369-11821391 TGGGGGGAGGATAGACTGGGTGG - Intergenic
1180384866 22:12170988-12171010 TGGGGGGAGGATAGACTGGGTGG + Intergenic
1184413362 22:44338300-44338322 CTTGGGTAGGGTGGACAGGGCGG + Intergenic
955495269 3:59524783-59524805 GGCAGGTAGCATAGACAGTGTGG - Intergenic
959905359 3:111705141-111705163 AGCAGGTAGGATAGAGAGGCTGG - Intronic
965764026 3:172110787-172110809 CGCAGGTTGGATTAACAGGGTGG - Intronic
967008701 3:185410342-185410364 GCTGGGGAGGATAGACAGGGAGG + Intronic
968285856 3:197508377-197508399 CCCAGGCAGGATAGGCAGGGTGG - Intergenic
973312599 4:48725635-48725657 GGTGGGTAGCATAGACAGTGTGG - Intronic
978820044 4:112956551-112956573 GGCGGGCAGCATAGACAGCGTGG + Intronic
985513298 5:323916-323938 CTCGGGTAGGAAAGACTTGGCGG + Intronic
985628875 5:1004792-1004814 CGCGGGGAGAATAGCCACGGGGG + Intergenic
989375550 5:40756313-40756335 GGCGGGGAGGCTAGTCAGGGAGG + Intergenic
991294440 5:65065658-65065680 GCTGGGGAGGATAGACAGGGTGG - Intergenic
997867086 5:137473484-137473506 AGTGGGCAGGATAAACAGGGTGG + Intronic
998331392 5:141330942-141330964 CGCGCGCAGGATAGACCGGGAGG + Exonic
998332781 5:141344291-141344313 CGCGGAGAGGATAGACCGGGAGG + Exonic
998334087 5:141355458-141355480 CGCGGGTAGGATAGACAGGGAGG + Exonic
998335092 5:141364588-141364610 CGCGGGCAGGATAGACCGGGAGG + Exonic
998336174 5:141374341-141374363 CGCGGGTAGGATAGACCGCGAGG + Exonic
998338201 5:141393071-141393093 CGCGGGCAGGATAGATCGGGAGG + Exonic
998339337 5:141403210-141403232 CGCGGGTAGGATAGACCGGGAGG + Exonic
998340497 5:141413445-141413467 CGCGGGCAGGATAGACCGGGAGG + Exonic
998341450 5:141421488-141421510 GGCAGGCAGGATAGACCGGGAGG + Exonic
998342537 5:141431017-141431039 GGCGGGCAGGATAGACCGGGAGG + Exonic
1000247492 5:159460834-159460856 AGTGGGTAGCATAGACAGTGTGG - Intergenic
1000366588 5:160496956-160496978 GGTGGGTAGCATAGACAGCGTGG + Intergenic
1005991890 6:30908382-30908404 CGCGAGGAGGATCGACAGAGTGG + Exonic
1017513266 6:155132966-155132988 CGTGGGTAGGAGACGCAGGGAGG - Intronic
1019294979 7:269281-269303 CGCTGGTGGGAAAGGCAGGGAGG + Intergenic
1020262719 7:6539684-6539706 AGGGGGCAGGATAGACAGGCAGG - Intronic
1027334021 7:77129224-77129246 GGTGGGTAGGGTAGACAGTGTGG - Intronic
1029781774 7:102742071-102742093 GGTGGGTAGGGTAGACAGTGTGG + Intergenic
1035533551 8:374383-374405 AGCAGGTAGTATAGACAGGGTGG + Intergenic
1035533558 8:374418-374440 GGCAGGTAGTATAGACAGGGCGG + Intergenic
1035533570 8:374488-374510 GGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533577 8:374523-374545 GGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533584 8:374558-374580 GGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533592 8:374593-374615 GGCAGGTAGGGTAGACAGGGCGG + Intergenic
1035533599 8:374628-374650 GGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533607 8:374663-374685 GGCAGGTAGTATAGACAGGGAGG + Intergenic
1035533618 8:374733-374755 GGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533624 8:374768-374790 GGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533631 8:374803-374825 GGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533638 8:374838-374860 GGCAGGTAGTATAGACAGGGTGG + Intergenic
1035533655 8:374946-374968 AGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533660 8:374981-375003 GGCAGGTAGTATAGACAGTGTGG + Intergenic
1035533678 8:375086-375108 GGCAGGTAGTGTAGACAGGGAGG + Intergenic
1035533692 8:375156-375178 GGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533697 8:375191-375213 GGCAGGTAGTATAGACAGGATGG + Intergenic
1035533708 8:375261-375283 GGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533714 8:375296-375318 GGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533720 8:375331-375353 GGCAGGTAATATAGACAGGGTGG + Intergenic
1035533726 8:375365-375387 GGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533739 8:375434-375456 GGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533745 8:375469-375491 GGCAGGTAGCATAGACAGGGTGG + Intergenic
1035533756 8:375539-375561 AGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533770 8:375609-375631 GGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533776 8:375644-375666 GGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533796 8:375749-375771 GGCAGGTAGTGTAGACAGGGCGG + Intergenic
1035533803 8:375784-375806 GGCAGGTAGTGTAGACAGGGTGG + Intergenic
1035533808 8:375819-375841 AGCAGGTAGTATAGACAGGGTGG + Intergenic
1038249785 8:25892519-25892541 TGGGGGTAGGATGGACTGGGAGG - Intronic
1046650588 8:116833018-116833040 CGTGGGTAGGGTGCACAGGGCGG + Intronic
1048675385 8:136772866-136772888 GGCGGGTAGTATATACAGTGTGG - Intergenic
1050242014 9:3646643-3646665 CCAGGGTAGGATAGACAGAGAGG + Intergenic
1051989376 9:23133061-23133083 TGCAGGGAGGAGAGACAGGGAGG + Intergenic
1055356058 9:75438100-75438122 GGCGGGTAGGGGAGATAGGGAGG + Intergenic
1056596021 9:88008202-88008224 GGAAGGTAGCATAGACAGGGTGG - Intergenic
1057226743 9:93296710-93296732 TGAGGGGAGGATAGAGAGGGAGG - Intronic
1203549846 Un_KI270743v1:157825-157847 CGGGGTGAGGATAGACTGGGTGG - Intergenic
1203550785 Un_KI270743v1:163990-164012 CGGGGTGAGGATAGACTGGGTGG - Intergenic
1190455114 X:50619433-50619455 CGCAAGGAGGATACACAGGGAGG + Intronic
1201380324 Y:13368925-13368947 TGTGGGTAGCATAGACAGTGTGG - Intronic