ID: 998335061

View in Genome Browser
Species Human (GRCh38)
Location 5:141364445-141364467
Sequence CTGGACAAAGGCTCCTTCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998335054_998335061 9 Left 998335054 5:141364413-141364435 CCGGGCAGATCCGCTACTCGATG 0: 1
1: 0
2: 1
3: 10
4: 26
Right 998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG 0: 1
1: 1
2: 3
3: 11
4: 76
998335057_998335061 -1 Left 998335057 5:141364423-141364445 CCGCTACTCGATGCCGGAGGAGC 0: 1
1: 2
2: 0
3: 4
4: 38
Right 998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG 0: 1
1: 1
2: 3
3: 11
4: 76
998335053_998335061 16 Left 998335053 5:141364406-141364428 CCAGGATCCGGGCAGATCCGCTA 0: 1
1: 0
2: 0
3: 0
4: 24
Right 998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG 0: 1
1: 1
2: 3
3: 11
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998335061 Original CRISPR CTGGACAAAGGCTCCTTCGT CGG Exonic
901287122 1:8089591-8089613 GAGGACAGAGGCTGCTTCGTGGG + Intergenic
903112120 1:21144762-21144784 CTGGTAAAATGCACCTTCGTGGG - Intronic
911829449 1:102532353-102532375 TTGGACAAAGGCTCATTCTGTGG + Intergenic
1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG + Intronic
1073561649 10:104502235-104502257 CAGGACAAAGGCTTCTTTGGAGG + Intergenic
1075486034 10:122822723-122822745 GTCTACAAAGGCTCCTTAGTGGG + Intergenic
1076214585 10:128682803-128682825 CTGGTCAGAGGCTCCTTGGCAGG - Intergenic
1077574994 11:3376181-3376203 CTGTAGAAAGGCTCCTTCCATGG + Intronic
1083757043 11:64797283-64797305 CTGGACAGAGGCTCCTCTGCTGG + Exonic
1087118622 11:94549324-94549346 CTGGACCTTGGCTCCTTCCTCGG - Exonic
1087491611 11:98834512-98834534 GTGGACACAGGCTCTTTCTTTGG - Intergenic
1087555910 11:99720757-99720779 TTGGACAAAAGCTCCTTCAGTGG + Intronic
1089073500 11:115718604-115718626 CTGGAGCCAGGCTCCTTCCTGGG + Intergenic
1093651554 12:21651438-21651460 CTGTACAAAGGGGCCTTAGTGGG + Intronic
1098374132 12:69795207-69795229 CCTGGCAAAGGCTCCTGCGTAGG - Exonic
1098527192 12:71499643-71499665 CTGCACAGAGTCTCCTTCATGGG + Intronic
1098751187 12:74294242-74294264 CTGGACAGGGGCTCCTGGGTGGG + Intergenic
1109872038 13:68344846-68344868 GTGGACAAATGATACTTCGTTGG + Intergenic
1111760258 13:92454703-92454725 GAGGACAAAGGCTCCATCTTTGG - Intronic
1113780785 13:112975948-112975970 CTGGACAAAGGCTCCTGGGGTGG - Intronic
1117246458 14:53891226-53891248 CTGGACCAAGGGTTCTGCGTGGG + Intergenic
1119765785 14:77186881-77186903 CTGGACCAGGGATCCTTCCTTGG + Intronic
1120599623 14:86485695-86485717 CTGGAGAAAGCCTCCTTCAGTGG - Intergenic
1121237183 14:92400542-92400564 CTGGACACAGTCGCCTTCTTTGG + Intronic
1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG + Intronic
1129058409 15:72839012-72839034 CTTGACAAAGGCTGTTTCGGTGG - Intergenic
1129315489 15:74740683-74740705 CTGGTCAGAGCCTCCTTCCTTGG - Intergenic
1130183839 15:81659446-81659468 CTGAATAAAGGCTCCTTCTTTGG + Intergenic
1130188143 15:81705314-81705336 CTGAATAAAGGCTCCTTCTTTGG + Intergenic
1134263750 16:12674923-12674945 CTGGAGAAAGCCTCCTGGGTGGG - Intronic
1138148870 16:54636992-54637014 CTGGACAAAGGATCTTTCTTAGG - Intergenic
1142402711 16:89869266-89869288 CTGGACAGGGGCTCCTTAGAGGG - Intronic
1152365742 17:79855410-79855432 CTGGACCAAGGCTCATGGGTTGG + Intergenic
1161580520 19:5078164-5078186 ATGGACAAAGGCTTCTCCATGGG - Intronic
1161741224 19:6022231-6022253 CTGGACAGAGGCCCCTTCTGAGG + Intronic
1163849352 19:19654596-19654618 CTGGACGACGGCACCCTCGTGGG - Exonic
1163908679 19:20169486-20169508 CAGGATAAAGGCTCCTTCCATGG - Intronic
1163969562 19:20779035-20779057 CAGGATAAAGGCTCCTTCTATGG - Intronic
1165117754 19:33539090-33539112 CTGGACAAAGACTCTCTCCTCGG + Intergenic
925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG + Intergenic
936047752 2:109200341-109200363 CTTTCCATAGGCTCCTTCGTGGG + Intronic
936269912 2:111041642-111041664 ATGGCCAAAGGCTGCTTCCTGGG - Intronic
938494384 2:131785624-131785646 CTGGGCATAGGCTTCTTCCTGGG + Intergenic
938989462 2:136612914-136612936 CTGGACCATGGCTCATTCCTGGG + Intergenic
1170053279 20:12170879-12170901 CTGGAAATAGGCTCCTTCAAAGG - Intergenic
1171142076 20:22752022-22752044 CTGGACAGAGGCTCCCTTGGTGG - Intergenic
1176262986 20:64192792-64192814 CTGGACAGAGGCTCCTGCAAGGG + Intronic
1179512671 21:41884243-41884265 CTGCAGAGAAGCTCCTTCGTGGG + Intergenic
1182303677 22:29353282-29353304 CACGACAAAGGCTCCTTGCTTGG - Intronic
1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG + Intronic
949504092 3:4710541-4710563 CAGGACAACGTCTCCTTCTTCGG - Intronic
952418328 3:33109275-33109297 CTGGGCAAAGGCTCTTTGGCAGG + Intergenic
952616367 3:35278310-35278332 CTGGACTCAGCCTCCTTCCTAGG - Intergenic
953500797 3:43431914-43431936 CTGGACACATACTCCTTCTTTGG - Intronic
958625059 3:96613110-96613132 CTGGCCAATGGCTCATTCTTTGG + Intergenic
961500172 3:127326769-127326791 CTGGACATAGACTCCTTTGAAGG - Intergenic
968438951 4:611948-611970 CTGGGGGAAGGCTCCTTCCTGGG + Intergenic
973541693 4:51941561-51941583 CTGGCCAAAGGCTCATGAGTGGG - Intergenic
977468374 4:97410659-97410681 CTGGAGGAAGCCTCCTTCATAGG + Intronic
982645210 4:158015515-158015537 CTGGAAAAAGGCTGGTTTGTGGG + Intergenic
985905306 5:2830624-2830646 CTGGACAAAGCCCCCTTCTGTGG + Intergenic
991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG + Intergenic
993493940 5:88586628-88586650 CTGGACTCAGCCTCCTTCCTAGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
997427035 5:133810299-133810321 CTGGACACAGGCTCCTGGGAAGG - Intergenic
998331367 5:141330799-141330821 ACAGACAAAGGTTCCTTCGTAGG + Exonic
998332195 5:141339086-141339108 ATCGACAGAGGCTCCTTCGTAGG + Exonic
998332755 5:141344148-141344170 CTAGATAAAGGTTCCTTCGTGGG + Exonic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
998337094 5:141383014-141383036 ACGGACAAAGGGTCCTTTGTGGG + Exonic
998338172 5:141392928-141392950 ACGGACAAAGGCTCCTTCGTGGG + Exonic
998340470 5:141413302-141413324 TTAGAGAAAGGCTCTTTCGTGGG + Exonic
1001286124 5:170425399-170425421 CTGGAGAAAGACTCCTGCATGGG - Intronic
1004014562 6:11720256-11720278 CTGGAGAAAGGCTCACTAGTAGG + Intronic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1021010798 7:15462958-15462980 CTGGGCAAAGGGTCCTTCCTGGG - Intronic
1022242924 7:28530351-28530373 CTGGACCACGGCCCCTTCCTAGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1030886453 7:114944440-114944462 CTAGACAAAGTCTACTTTGTTGG + Intronic
1036658546 8:10692986-10693008 CTGGAGAAAGACTCCATCGGGGG + Intronic
1042705753 8:71664425-71664447 CTGGGCAAAGGCTCCTTCTTTGG - Intergenic
1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG + Intergenic
1046528705 8:115415574-115415596 CTGGAGACAGGGTCCTTAGTAGG + Intronic
1049035390 8:140071546-140071568 CTGGACAAAGGGGCCTTCCCTGG + Intronic
1061221194 9:129253251-129253273 CTGGACAAAGGGGCCTTTGGAGG + Intergenic
1190254447 X:48752141-48752163 CTGGACACTGGCTCCATTGTGGG - Intergenic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1195214216 X:102682111-102682133 CTGGACAAAGCATTCTTAGTTGG + Intergenic
1196886835 X:120254022-120254044 CTCGGCAAAGTCTCCTTTGTGGG - Exonic
1199252210 X:145676267-145676289 CTGGACAATGGCTTCTTTCTGGG + Intergenic
1201327588 Y:12780933-12780955 CTGGAAAATGGCTCATTTGTAGG - Intronic