ID: 998335082

View in Genome Browser
Species Human (GRCh38)
Location 5:141364558-141364580
Sequence AGCTGCCGCTTCGCGGGTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998335082_998335089 3 Left 998335082 5:141364558-141364580 CCTGAACCCGCGAAGCGGCAGCT 0: 1
1: 0
2: 3
3: 5
4: 138
Right 998335089 5:141364584-141364606 TCACCGCGGGCAGGATAGACCGG 0: 2
1: 6
2: 2
3: 4
4: 41
998335082_998335090 4 Left 998335082 5:141364558-141364580 CCTGAACCCGCGAAGCGGCAGCT 0: 1
1: 0
2: 3
3: 5
4: 138
Right 998335090 5:141364585-141364607 CACCGCGGGCAGGATAGACCGGG 0: 2
1: 6
2: 3
3: 4
4: 69
998335082_998335087 -10 Left 998335082 5:141364558-141364580 CCTGAACCCGCGAAGCGGCAGCT 0: 1
1: 0
2: 3
3: 5
4: 138
Right 998335087 5:141364571-141364593 AGCGGCAGCTTGGTCACCGCGGG 0: 1
1: 7
2: 1
3: 5
4: 57
998335082_998335092 7 Left 998335082 5:141364558-141364580 CCTGAACCCGCGAAGCGGCAGCT 0: 1
1: 0
2: 3
3: 5
4: 138
Right 998335092 5:141364588-141364610 CGCGGGCAGGATAGACCGGGAGG 0: 2
1: 4
2: 4
3: 6
4: 49
998335082_998335088 -6 Left 998335082 5:141364558-141364580 CCTGAACCCGCGAAGCGGCAGCT 0: 1
1: 0
2: 3
3: 5
4: 138
Right 998335088 5:141364575-141364597 GCAGCTTGGTCACCGCGGGCAGG 0: 1
1: 5
2: 4
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998335082 Original CRISPR AGCTGCCGCTTCGCGGGTTC AGG (reversed) Exonic
901377505 1:8849761-8849783 AACCGCTGCTTCCCGGGTTCAGG + Intergenic
901793291 1:11665640-11665662 AACCTCCGCTTCCCGGGTTCAGG + Intronic
902240868 1:15088525-15088547 GGCTGCCGAGTCGCGGGTGCTGG - Intronic
903016629 1:20366103-20366125 AGCTGCGGCTTTGCGGGGTTTGG - Intergenic
906193985 1:43918198-43918220 AGCTGCCGCCTCCAGGGCTCCGG + Intronic
907363852 1:53944561-53944583 AGCCTCCGCTTCCTGGGTTCAGG - Intronic
908418230 1:63934024-63934046 AGCTGCTGCTTTGCAGGTGCAGG + Intronic
914801357 1:150964942-150964964 AGCCTCCGCCTCCCGGGTTCAGG + Intronic
918208282 1:182328715-182328737 AGCTGCGGCTGTGTGGGTTCAGG + Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921239997 1:213169861-213169883 AACCTCCGCTTCCCGGGTTCAGG + Intronic
922434656 1:225591681-225591703 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1063510573 10:6641332-6641354 AGCCCCCGCCTCCCGGGTTCAGG - Intergenic
1064071916 10:12237513-12237535 AGCTTCCACCTCCCGGGTTCAGG + Intronic
1064471839 10:15643359-15643381 AGCCTCCGCCTCCCGGGTTCAGG + Intronic
1066183467 10:32985711-32985733 AGCTGCCTCTTTGGGGCTTCAGG - Intronic
1067682845 10:48451215-48451237 AGCTGCAGCTTCGTGGGAGCTGG + Intronic
1069543023 10:69309717-69309739 AACTTCCGCCTCCCGGGTTCAGG - Intronic
1070610038 10:77926697-77926719 AGCGGCCGCCTCCCGGGCTCCGG + Intergenic
1074124353 10:110516387-110516409 AGCCTCCGCCTCCCGGGTTCAGG + Intergenic
1077069129 11:659874-659896 AGCTTCCGGTTCACGGCTTCAGG - Intronic
1081202116 11:40229352-40229374 AACTTCCGCCTCCCGGGTTCAGG + Intronic
1083883736 11:65560661-65560683 AGCTGCAGACTCCCGGGTTCGGG - Intergenic
1089437532 11:118483149-118483171 AGCCTCCGCCTCGCAGGTTCAGG - Intronic
1091309486 11:134562466-134562488 AGCTGCCTCTCCGCTTGTTCTGG + Intergenic
1093818314 12:23578037-23578059 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1094187973 12:27665104-27665126 AACCTCCGCTTCCCGGGTTCAGG - Intronic
1094629494 12:32159013-32159035 AACCTCCGCTTCCCGGGTTCAGG + Intronic
1095893669 12:47258794-47258816 AACTTCCACTTCCCGGGTTCAGG - Intergenic
1097227513 12:57487056-57487078 AACCTCCGCTTCCCGGGTTCAGG + Intronic
1101142310 12:101808864-101808886 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1102185717 12:110947004-110947026 AACTTCCGCCTCCCGGGTTCAGG + Intergenic
1102517672 12:113461176-113461198 AACCTCCGCTTCCCGGGTTCAGG + Intergenic
1102867620 12:116386640-116386662 AGCCTCCGCCTCCCGGGTTCAGG + Intergenic
1103089586 12:118088161-118088183 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1103571428 12:121847617-121847639 AGCTGCCACTTCCTGGGTCCAGG + Intronic
1106750835 13:32765683-32765705 AACCTCCGCTTCCCGGGTTCAGG + Intronic
1110319837 13:74148894-74148916 AGCCTCCGCCTCCCGGGTTCAGG + Intergenic
1111991906 13:95124794-95124816 AGCTTCCGCCTCCCAGGTTCAGG - Intronic
1114488008 14:23075784-23075806 ACCTTCCGCCTCCCGGGTTCAGG + Intronic
1115411260 14:33078055-33078077 AGCCTCCACTTCCCGGGTTCAGG - Intronic
1115944890 14:38648757-38648779 AGCCTCCCCTTCCCGGGTTCAGG - Intergenic
1117135503 14:52730710-52730732 CGCTGCCCCTCCGCGGGGTCTGG - Intronic
1117364433 14:55011440-55011462 AACCGCCGCCTCCCGGGTTCAGG - Intronic
1119247262 14:73122355-73122377 AACTTCCGCCTCCCGGGTTCTGG + Exonic
1202926746 14_KI270724v1_random:32538-32560 AACCTCCGCTTCCCGGGTTCAGG + Intergenic
1125982953 15:44019653-44019675 AACCTCCGCTTCCCGGGTTCAGG - Intronic
1130527133 15:84716801-84716823 AACCTCCGCCTCGCGGGTTCAGG + Intergenic
1132065380 15:98726799-98726821 AACTTCCGCCTCCCGGGTTCAGG + Intronic
1132520099 16:383032-383054 AACCTCCGCTTCCCGGGTTCAGG - Intronic
1132894243 16:2220425-2220447 AACCTCCGCTTCCCGGGTTCAGG + Intergenic
1133047086 16:3094425-3094447 AACCTCCGCCTCGCGGGTTCCGG + Intronic
1133362410 16:5185087-5185109 AACTTCCGCTTCCGGGGTTCAGG + Intergenic
1135132683 16:19866009-19866031 AACCTCCGCTTCCCGGGTTCAGG + Intronic
1135282564 16:21165327-21165349 AACTTCCGCTTCCCAGGTTCAGG - Intronic
1136453869 16:30369870-30369892 AGCTGCGGCTTTGGGGCTTCGGG + Exonic
1138430879 16:56968265-56968287 AACTTCCGCCTCGTGGGTTCAGG + Intronic
1139509476 16:67418747-67418769 AGCTTCCACCTCCCGGGTTCAGG + Intergenic
1139617329 16:68105958-68105980 AGCCTCCGCTTCCTGGGTTCAGG + Intronic
1141895147 16:86954373-86954395 AGCTGCAGCCTGGAGGGTTCTGG - Intergenic
1144349208 17:14378564-14378586 AGCCTCCGCCTCCCGGGTTCAGG + Intergenic
1146187940 17:30737601-30737623 AACCTCCGCTTCCCGGGTTCAGG + Intergenic
1146332803 17:31941932-31941954 AACCTCCGCTTCCCGGGTTCAGG + Intronic
1147599155 17:41734959-41734981 AGCTGCCGCGCCGGGGTTTCGGG + Intergenic
1147710195 17:42458181-42458203 AGCCTCCGCCTCCCGGGTTCAGG - Intergenic
1148569988 17:48660509-48660531 AGCTTCCCCTTCCCAGGTTCAGG - Intergenic
1148725456 17:49786693-49786715 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1150270777 17:63863231-63863253 AACTGCAGCCTCCCGGGTTCAGG + Intergenic
1150274406 17:63886752-63886774 AACTGCAGCCTCCCGGGTTCAGG + Intergenic
1152888475 17:82866506-82866528 AGCTGCCGCTTCACCTGTGCTGG + Intronic
1160171228 18:76557169-76557191 AGCCTCCGCCTCCCGGGTTCCGG + Intergenic
1161878023 19:6926975-6926997 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1161957491 19:7504622-7504644 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1162413658 19:10521028-10521050 AACTGTCTCTTCCCGGGTTCAGG + Intergenic
1166611955 19:44206432-44206454 AACCGCCGCCTCGCAGGTTCAGG + Intergenic
1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG + Intronic
925972924 2:9119885-9119907 AACTTCCGCCTCCCGGGTTCAGG - Intergenic
929677413 2:43950986-43951008 AACCTCCGCTTCCCGGGTTCAGG - Intronic
931674519 2:64680988-64681010 AACTTCCGCCTCCCGGGTTCAGG - Intronic
935532016 2:104245189-104245211 AACTTCTGCTTCCCGGGTTCAGG - Intergenic
938632136 2:133178421-133178443 AACTTCCACTTCCCGGGTTCAGG - Intronic
941664908 2:168235117-168235139 AACCACCGCTTCTCGGGTTCAGG + Intronic
1171781841 20:29426696-29426718 AACCTCCGCTTCCCGGGTTCAGG - Intergenic
1171965537 20:31527254-31527276 AGCCTCCGCTTCCTGGGTTCAGG - Intronic
1172418986 20:34797810-34797832 AGCTGCCGCCTCCCAGGTTCAGG - Intronic
1175445121 20:59014740-59014762 AGCAGCCGATTCGGGGTTTCTGG + Intergenic
1176047853 20:63101973-63101995 GGCTGCTGCTCCGCGGGCTCTGG + Intergenic
1178377834 21:32082705-32082727 AGCTGCAGCATCTTGGGTTCAGG - Intergenic
1178954778 21:37012317-37012339 AACCTCCGCTTCCCGGGTTCAGG + Intronic
1181584267 22:23844610-23844632 AGCTGCTGCTATGTGGGTTCCGG - Intergenic
1182592376 22:31391495-31391517 AACCGCCACTTCCCGGGTTCAGG - Intergenic
1182627626 22:31659671-31659693 AACTTCCGCCTCCCGGGTTCAGG + Intronic
1183449268 22:37882593-37882615 AGCTTCTGCTTCCCAGGTTCAGG - Intronic
951846713 3:27092479-27092501 AGCTGCCTCTTCTCGGGTGATGG - Intergenic
952150196 3:30581037-30581059 AACTTCCGCCTCCCGGGTTCAGG + Intergenic
954036651 3:47854492-47854514 GGCTGCTGCTGCTCGGGTTCAGG - Intronic
957083670 3:75659698-75659720 AACCTCCGCTTCCCGGGTTCAGG + Intergenic
960576796 3:119238183-119238205 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
963120740 3:141774872-141774894 AGCTTCCGCCTCCTGGGTTCAGG + Intergenic
964215633 3:154278556-154278578 AGCCTCCGCCTCCCGGGTTCCGG + Intronic
965918433 3:173881178-173881200 AACTGCCGCCTCCTGGGTTCAGG + Intronic
966814683 3:183880481-183880503 AACCTCCGCTTCCCGGGTTCAGG + Intronic
967207488 3:187137426-187137448 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
968020183 3:195378777-195378799 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
968064721 3:195752320-195752342 AGGGGGCGCTTGGCGGGTTCAGG - Intronic
977799020 4:101203411-101203433 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
981927691 4:150157592-150157614 AGCCTCCACTTCCCGGGTTCAGG + Intronic
987050594 5:14144181-14144203 AGCCGCGGCTTCGCGGGTTGGGG + Intronic
988311803 5:29568629-29568651 AACCTCCGCTTCCCGGGTTCAGG + Intergenic
989011376 5:36876592-36876614 AGCTGCCGCCTCCCGGCTGCTGG + Intergenic
990551816 5:56889248-56889270 AGCCTCCGCTTCCCAGGTTCAGG + Intronic
996404646 5:123093722-123093744 AGTGGCCTCTTCCCGGGTTCTGG + Intronic
997844168 5:137270918-137270940 AGCCTCTGCTTCCCGGGTTCAGG - Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
998342528 5:141430987-141431009 AGCTGCCGCTGCGCGGATTCAGG - Exonic
1002293787 5:178217300-178217322 AGCTGCCGCCTCCCAGGTTCAGG + Intronic
1003071885 6:2951302-2951324 AGCCTCCGCCTCCCGGGTTCAGG - Intronic
1004023825 6:11799556-11799578 AGCATCCGCCTCCCGGGTTCAGG - Intronic
1006271076 6:32968315-32968337 AGGTGCGGCTTCGCTGGTCCTGG - Intronic
1006341170 6:33447901-33447923 AGCAGCCTCTTCTTGGGTTCTGG - Exonic
1006856907 6:37140123-37140145 AGCCTCCGCCTCCCGGGTTCAGG - Intergenic
1007666162 6:43514157-43514179 AACCTCCGCTTCCCGGGTTCAGG - Intronic
1007676381 6:43599068-43599090 AGCCTCCGCCTCCCGGGTTCAGG + Intronic
1007773002 6:44206311-44206333 AACTGCCGCCTCCTGGGTTCAGG + Intergenic
1007788937 6:44297871-44297893 AGCGGCCGCTTTGCGGGTAGTGG + Intronic
1020122122 7:5510602-5510624 AGCCACCACTTCCCGGGTTCAGG - Intronic
1023416626 7:39939225-39939247 AACCTCCGCTTCCCGGGTTCAGG - Intergenic
1024482857 7:49883210-49883232 AGGTTCCGCTTGGCAGGTTCGGG - Intronic
1028156399 7:87434664-87434686 AACCTCCGCTTCCCGGGTTCAGG - Intronic
1029562653 7:101313415-101313437 AGTCTCCGCCTCGCGGGTTCAGG + Intronic
1033191594 7:139285822-139285844 AACCTCCGCTTCTCGGGTTCAGG + Intronic
1034635872 7:152566767-152566789 AACCTCCGCTTCCCGGGTTCAGG + Intergenic
1035736633 8:1892252-1892274 AGCTGCAGCTTCCCAGCTTCTGG + Intronic
1041369871 8:57147853-57147875 AACCTCCGCTTCCCGGGTTCAGG - Intergenic
1050160824 9:2717562-2717584 AGCTGCCCCTTCTCAGGTCCTGG - Exonic
1052235918 9:26213482-26213504 AGCTTCCGCCTCCCGGGTTCAGG - Intergenic
1055475637 9:76660698-76660720 AACTTCCGCCTCCCGGGTTCAGG - Intronic
1056941682 9:90961584-90961606 AGCACCCGCTTTGCAGGTTCTGG + Intergenic
1057811784 9:98262953-98262975 AGCCTCCGCCTCCCGGGTTCAGG - Intergenic
1058251650 9:102705393-102705415 AGCCACCGCCTCCCGGGTTCAGG - Intergenic
1058912339 9:109533035-109533057 AACCTCCGCTTCCCGGGTTCAGG + Intergenic
1062424192 9:136498455-136498477 AGCTGCCGCCACGCGTGTTCTGG + Intronic
1187505606 X:19875877-19875899 AGCTGCTGCTTCTTGGGGTCCGG + Intronic
1196420879 X:115519797-115519819 AGCTTCAACTTCCCGGGTTCAGG - Intergenic
1201381204 Y:13381440-13381462 AGCCTCCGCCTCCCGGGTTCAGG - Intronic