ID: 998335240

View in Genome Browser
Species Human (GRCh38)
Location 5:141365765-141365787
Sequence CGAGCGTTGTCGCCGCTGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 14}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998335240_998335242 -6 Left 998335240 5:141365765-141365787 CCCGACAGCGGCGACAACGCTCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 998335242 5:141365782-141365804 CGCTCGAGTCACCTACTCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 48
998335240_998335247 13 Left 998335240 5:141365765-141365787 CCCGACAGCGGCGACAACGCTCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 998335247 5:141365801-141365823 CTGGCTGAAGACACATTTCAGGG 0: 1
1: 0
2: 0
3: 18
4: 204
998335240_998335248 14 Left 998335240 5:141365765-141365787 CCCGACAGCGGCGACAACGCTCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 998335248 5:141365802-141365824 TGGCTGAAGACACATTTCAGGGG 0: 1
1: 0
2: 1
3: 27
4: 225
998335240_998335249 15 Left 998335240 5:141365765-141365787 CCCGACAGCGGCGACAACGCTCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 998335249 5:141365803-141365825 GGCTGAAGACACATTTCAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 187
998335240_998335246 12 Left 998335240 5:141365765-141365787 CCCGACAGCGGCGACAACGCTCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 998335246 5:141365800-141365822 CCTGGCTGAAGACACATTTCAGG 0: 1
1: 0
2: 1
3: 26
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998335240 Original CRISPR CGAGCGTTGTCGCCGCTGTC GGG (reversed) Exonic
921358722 1:214310795-214310817 CTAGGGTAGTTGCCGCTGTCAGG + Intronic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1087912847 11:103773725-103773747 CGAGCGTGGTGGCCGGTGCCTGG - Intergenic
1113967904 13:114164912-114164934 CAAGCGTCCTCGTCGCTGTCTGG + Intergenic
1142229834 16:88895031-88895053 TGAGTGTTGTGGCCTCTGTCTGG + Intronic
1152070761 17:78132578-78132600 CCAGCGTTGTCGCCACGCTCTGG - Intronic
1163845224 19:19634841-19634863 CGAGCGTTGGTGGAGCTGTCGGG - Exonic
929254186 2:39791639-39791661 CGAGAGTTGTCGCTGCAGGCTGG + Intergenic
953931971 3:47010014-47010036 CGGGTGTTGTCGCCCCTGCCCGG - Intergenic
998332373 5:141340406-141340428 TGAGCATTGTCGTTGCTGTCGGG - Exonic
998334228 5:141356635-141356657 CGGGCATTGTCACCACTGTCAGG - Exonic
998335240 5:141365765-141365787 CGAGCGTTGTCGCCGCTGTCGGG - Exonic
1007622035 6:43221268-43221290 CAAGCGCTGTCCCAGCTGTCAGG + Exonic
1034549866 7:151813675-151813697 CGTGGGCTGTCACCGCTGTCTGG - Intronic
1035927922 8:3748862-3748884 CAAGCTTTATCGCCACTGTCAGG + Intronic