ID: 998335893

View in Genome Browser
Species Human (GRCh38)
Location 5:141371902-141371924
Sequence CCGCGCGCTCACGGACACGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 2, 2: 2, 3: 1, 4: 29}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998335893 Original CRISPR CCGCGCGCTCACGGACACGT AGG (reversed) Exonic
901007910 1:6180504-6180526 CCGCGCGCCCGCGGACCCGACGG + Intergenic
903652865 1:24931910-24931932 CCGCGCGCCCTCGGACGCGCTGG + Intronic
914748359 1:150515592-150515614 TCGCGTGCTGACGGACAGGTGGG - Intergenic
923337968 1:232986292-232986314 CGGCCCGCTCACGGACACTCAGG + Exonic
1100391627 12:94149583-94149605 CATCGCGCTCAAGGACACGGAGG + Exonic
1104942065 12:132399822-132399844 CCGCGGGCTCCCGGACGCCTGGG + Intergenic
1119179702 14:72597477-72597499 CCGAGAGGTCAGGGACACGTAGG - Intergenic
1129919803 15:79310875-79310897 CTGCGCGCTCCCGGACCCGCAGG - Intergenic
1132589788 16:721602-721624 CCGCGCGCTCGCGCCGACGTAGG - Exonic
1132738274 16:1397938-1397960 CTCTGCGCTCACGGACACGCAGG + Intronic
1132943565 16:2520277-2520299 CCGGGCGCTGCCGGTCACGTGGG + Intronic
1141677891 16:85527215-85527237 CTGCGCGCCCACGGACCAGTGGG - Intergenic
1144062752 17:11598587-11598609 CCGCAGGCTCATGGCCACGTAGG - Exonic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1147157687 17:38552460-38552482 CCGCGGGGTCACGGACACGCTGG - Exonic
1148896255 17:50840841-50840863 CATCTCGCTCACGGTCACGTTGG - Exonic
1152705446 17:81841272-81841294 CCGCGTACTCACGGAAAAGTGGG - Intergenic
1152824841 17:82458405-82458427 CCGCGCGCTCACCGACTCCCTGG + Intronic
1158154216 18:54407125-54407147 CCGCGGGCTCACGGATGCCTTGG + Intergenic
1159036564 18:63284055-63284077 CAGCGCGCTCAGGGACACACTGG - Intronic
1162932486 19:13963846-13963868 CCCCGCGCTCACCTGCACGTTGG + Exonic
1163678664 19:18668420-18668442 CCGCGAGCTCACGGAGATGGAGG + Exonic
937033675 2:118763039-118763061 CAGGGCGATCAAGGACACGTGGG + Intergenic
949709994 3:6861678-6861700 CCGCGCGCCCAGCGTCACGTTGG - Exonic
950749653 3:15118771-15118793 CCGCGCGCTCGCGCTCAGGTGGG - Intergenic
970394865 4:15655470-15655492 CTGCGCGCGCCCGGTCACGTGGG - Intronic
998333682 5:141351756-141351778 CTGCGGGCTCACGGACACGTAGG - Exonic
998334762 5:141361643-141361665 CTGCGCGCTCACGGACACGTAGG - Exonic
998335893 5:141371902-141371924 CCGCGCGCTCACGGACACGTAGG - Exonic
998337853 5:141389386-141389408 CTCCGCGCTTATGGACACGTAGG - Exonic
998341178 5:141419367-141419389 CTGCGCGCTCACGGACACGTAGG - Exonic
998342155 5:141427786-141427808 CTGTGCGCTCACGGACACGTAGG - Intronic
1006324899 6:33346335-33346357 CCGGGCCATCACGGACACTTTGG + Intergenic
1024991827 7:55240801-55240823 CTGCGTGCTCAAGGACAGGTGGG - Intronic
1192436081 X:71144802-71144824 CTGCGCGTTCCCGGACACGGGGG - Intergenic