ID: 998336150

View in Genome Browser
Species Human (GRCh38)
Location 5:141374198-141374220
Sequence CTGGAGAAAGGCTCCTTCGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998336145_998336150 -1 Left 998336145 5:141374176-141374198 CCGCTACTCTATTCCCGAGGAGC 0: 1
1: 1
2: 2
3: 5
4: 61
Right 998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG 0: 1
1: 1
2: 0
3: 19
4: 139
998336143_998336150 15 Left 998336143 5:141374160-141374182 CCGCGGCAGCGCAGATCCGCTAC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG 0: 1
1: 1
2: 0
3: 19
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998336150 Original CRISPR CTGGAGAAAGGCTCCTTCGT AGG Exonic
902917277 1:19646243-19646265 CTGGAGCCAGGCTCCTCCCTGGG + Intronic
903112120 1:21144762-21144784 CTGGTAAAATGCACCTTCGTGGG - Intronic
907781571 1:57571846-57571868 GTGGGGAAAGGCTCCTTCACTGG + Intronic
907913614 1:58848918-58848940 CAGGGGAAAGCTTCCTTCGTGGG + Intergenic
909586701 1:77298313-77298335 CTGAAGAAAGTTTCCTTAGTTGG - Intronic
920305134 1:205013892-205013914 CTGCAGACAGGCTCCTGTGTGGG - Intronic
924818884 1:247468857-247468879 CTGGAGACAGGATCTTTGGTAGG + Intergenic
1065822710 10:29540618-29540640 CTGGAAAATGGCTGCTTCCTTGG + Intronic
1067008827 10:42691145-42691167 CTGGAGCCTGGCTCCTTCCTTGG + Intergenic
1067204746 10:44203027-44203049 CTTGAGGCAGGCTCCCTCGTGGG + Intergenic
1067517287 10:46962083-46962105 CTTGAGAAATCCTCCTTTGTGGG - Intronic
1067644961 10:48089746-48089768 CTTGAGAAATCCTCCTTTGTGGG + Intergenic
1071518829 10:86316483-86316505 CTGGAGAAAGGCTCTTTGTCTGG - Intronic
1073064786 10:100751544-100751566 CTGGAGACAGGCACCTTAGGTGG - Intronic
1074302468 10:112245117-112245139 CTCGAGAAATTCTCCTTCCTTGG + Intergenic
1077574994 11:3376181-3376203 CTGTAGAAAGGCTCCTTCCATGG + Intronic
1080579992 11:33634392-33634414 CTGGAGAAAGGCACCCTTGGAGG - Intronic
1089073500 11:115718604-115718626 CTGGAGCCAGGCTCCTTCCTGGG + Intergenic
1091656252 12:2348733-2348755 CGGGGGAAAGGTTCCTTCCTCGG + Intronic
1093441308 12:19199994-19200016 CTGGAGAAAGGTTGGTTAGTGGG + Intronic
1094874762 12:34628271-34628293 CTAGAGAAAAGCACCCTCGTTGG + Intergenic
1095215764 12:39545520-39545542 TTGGAGAAAGACTGCTTGGTGGG - Intergenic
1096085496 12:48862762-48862784 CTAGAGCAAGAGTCCTTCGTTGG + Intronic
1101175906 12:102151444-102151466 CTGCAGAAATGGTCCTTAGTTGG + Intronic
1105721940 13:23125277-23125299 CCGAAGAAAGGCTTCTTCCTTGG + Intergenic
1108187436 13:47902076-47902098 CTGGAGATAGGCTTCTTGTTGGG - Intergenic
1111097112 13:83531325-83531347 CTGGAGAAAGGCTTGCTTGTTGG - Intergenic
1113780785 13:112975948-112975970 CTGGACAAAGGCTCCTGGGGTGG - Intronic
1120416176 14:84220968-84220990 CTTGAGAAAGCCTCCTTGATTGG + Intergenic
1120517688 14:85489993-85490015 CTGTGGAAAGGCTCTTTCTTGGG - Intergenic
1120599623 14:86485695-86485717 CTGGAGAAAGCCTCCTTCAGTGG - Intergenic
1121016703 14:90553274-90553296 CTGGAGAAATGCACCTTCTGGGG + Intronic
1121595043 14:95156604-95156626 CTGAAGAAAGGGTCCTCCGCAGG + Intronic
1125323126 15:38509894-38509916 GTGGAGAAATGGTACTTCGTAGG - Intronic
1127264827 15:57352940-57352962 CTGCAGAAAGGTTCCATCCTGGG + Intergenic
1128541254 15:68535148-68535170 CTGAAGAAATGATCCTTCCTCGG - Intergenic
1130183839 15:81659446-81659468 CTGAATAAAGGCTCCTTCTTTGG + Intergenic
1130188143 15:81705314-81705336 CTGAATAAAGGCTCCTTCTTTGG + Intergenic
1132070010 15:98768118-98768140 GTGGAGAAAGGCTTTTTAGTTGG - Intronic
1134263750 16:12674923-12674945 CTGGAGAAAGCCTCCTGGGTGGG - Intronic
1134683024 16:16139702-16139724 GTGGAGAAAGCCACCTCCGTAGG + Intronic
1136665405 16:31807152-31807174 CTGAAGAAAGGGTTCTTCTTGGG + Intergenic
1138148870 16:54636992-54637014 CTGGACAAAGGATCTTTCTTAGG - Intergenic
1140166540 16:72558295-72558317 CTGGAGAAAGCTTCCTTCTATGG + Intergenic
1146640325 17:34535913-34535935 CTGGAGACAGGCTTCTCCATGGG + Intergenic
1148876505 17:50690446-50690468 CTGGAGAAGTGCTCCTCCATGGG - Intronic
1149407816 17:56372587-56372609 CTGGGGAAATGCTGCTTCATTGG - Intronic
1149799875 17:59557402-59557424 ATGGAGAATAGCTCCTTCCTGGG - Intergenic
1153382077 18:4451586-4451608 CTAGAGAAAGTCACCTTCATCGG + Intronic
1153771858 18:8423158-8423180 CTGGTGACAGCCTCCCTCGTGGG + Intergenic
1154172514 18:12061680-12061702 GAGGAGGAAGGCTCCTTCCTTGG - Intergenic
1159217109 18:65407534-65407556 CTGGTGAAAGCCTCCATCCTTGG - Intergenic
1163908679 19:20169486-20169508 CAGGATAAAGGCTCCTTCCATGG - Intronic
1163969562 19:20779035-20779057 CAGGATAAAGGCTCCTTCTATGG - Intronic
1165607100 19:37115166-37115188 CTAGAGAAAAGCACCTACGTTGG + Intronic
1165947400 19:39452504-39452526 CTGGAGAAATGCTCCTCTCTTGG - Intronic
1167571022 19:50289266-50289288 CTGCTGAACGGCTCCTTCCTAGG - Intronic
925306639 2:2851480-2851502 CTGGAGACAGGCTCCCTCCTGGG + Intergenic
928375246 2:30768497-30768519 CTGGAGCAAGGCTCTGGCGTTGG - Intronic
932781237 2:74560026-74560048 CTGGAGGAAGGCTACTCCCTTGG + Intronic
933024466 2:77237694-77237716 CTGGAGAAAGCCTCGTTTGGTGG + Intronic
941141468 2:161788645-161788667 CTGGAGAAATGCCCCTTTGGTGG + Intronic
1169914652 20:10673432-10673454 CCGGAGAAGGGCTCCTACCTTGG + Exonic
1170053279 20:12170879-12170901 CTGGAAATAGGCTCCTTCAAAGG - Intergenic
1170095972 20:12646465-12646487 CTGGTGAAAGGCTTCTTGCTGGG - Intergenic
1171092660 20:22300602-22300624 CTGGAGACAGGCTCCTCACTAGG - Intergenic
1171104659 20:22421061-22421083 CTGGAGAAAGGCCCCTGTGGAGG - Intergenic
1172130165 20:32650130-32650152 CTGGAGAATGGCTTCTCCCTTGG - Intergenic
1175067032 20:56297841-56297863 GTGCAGAAAGGCTCTTTCGGAGG + Intergenic
1175685143 20:61023518-61023540 CTGGTGAAGGGCTCCTTCCGTGG - Intergenic
1176336687 21:5605522-5605544 CTGGAGAAACCCTCCTTCTGGGG - Intergenic
1176391070 21:6215426-6215448 CTGGAGAAACCCTCCTTCTGGGG + Intergenic
1176470349 21:7100748-7100770 CTGGAGAAACCCTCCTTCTGGGG - Intergenic
1176493910 21:7482526-7482548 CTGGAGAAACCCTCCTTCTGGGG - Intergenic
1176506732 21:7655857-7655879 CTGGAGAAACCCTCCTTCTGGGG + Intergenic
1179512671 21:41884243-41884265 CTGCAGAGAAGCTCCTTCGTGGG + Intergenic
1179656545 21:42849496-42849518 CTGGAGAGTGGCTCCCTTGTGGG - Exonic
1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG + Intronic
1184622935 22:45696541-45696563 CAGGAGAAAAGCTTCTGCGTGGG - Intronic
1185131522 22:49041931-49041953 CCTGAGAAAGGCCCTTTCGTGGG - Intergenic
952169495 3:30791325-30791347 CTGGAGAAAGCTTTCTTCATAGG - Intronic
959809952 3:110605086-110605108 CTGGAGATAGGATCCTTGCTTGG - Intergenic
960074548 3:113469891-113469913 CTGTGGACAGGCTCCTTTGTAGG - Intronic
968396359 4:242210-242232 CTAGAGAAAGGCACCCACGTTGG - Intergenic
968438951 4:611948-611970 CTGGGGGAAGGCTCCTTCCTGGG + Intergenic
972350392 4:38231231-38231253 CTTGAGAAAGGTTCCTTCCGGGG - Intergenic
974249889 4:59372074-59372096 CTGGAGCAAAGCTTCTTTGTGGG - Intergenic
977468374 4:97410659-97410681 CTGGAGGAAGCCTCCTTCATAGG + Intronic
977637453 4:99315944-99315966 CTGGAGAAAGTCTGCCTCATTGG - Exonic
977639851 4:99344908-99344930 CTGGAGAAAGTCTGCCTCATTGG - Exonic
982645210 4:158015515-158015537 CTGGAAAAAGGCTGGTTTGTGGG + Intergenic
984317072 4:178141434-178141456 CTGGAGAAGGGTTCCTTCCCTGG - Intergenic
984863766 4:184263228-184263250 CTGAAGAAAGGCTCCATCCATGG + Intergenic
985219967 4:187693566-187693588 CTGGAGGAAGGTTTCTTCCTTGG + Intergenic
988909263 5:35823446-35823468 CTGGAGACAGATTCCTTCCTAGG - Intergenic
991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG + Intergenic
993037679 5:82774999-82775021 CTGTAGAGAAACTCCTTCGTAGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
998332195 5:141339086-141339108 ATCGACAGAGGCTCCTTCGTAGG + Exonic
998332755 5:141344148-141344170 CTAGATAAAGGTTCCTTCGTGGG + Exonic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
998338172 5:141392928-141392950 ACGGACAAAGGCTCCTTCGTGGG + Exonic
998340470 5:141413302-141413324 TTAGAGAAAGGCTCTTTCGTGGG + Exonic
998342504 5:141430874-141430896 CTGGAGAAAGGCTCTAGGGTGGG + Exonic
998420124 5:141977132-141977154 TTGGAGAATGGCTTCTTCATAGG + Intronic
1000203008 5:159030509-159030531 CTGGAGAAAGCCTCCTGCAGAGG + Intronic
1000410794 5:160933865-160933887 CTGGAGAAGGGTTCCTTCCCTGG + Intergenic
1001031877 5:168269161-168269183 CTGGAGAGAGGATCCTTGGCCGG - Intergenic
1001286124 5:170425399-170425421 CTGGAGAAAGACTCCTGCATGGG - Intronic
1002185898 5:177454725-177454747 CCGGGGAAAGCCTCCTCCGTGGG - Intronic
1002191702 5:177481668-177481690 CTGGAGAAGGGCTCCAGCTTAGG - Intergenic
1002449170 5:179309298-179309320 CTGGAGAAAGGCCACCTCTTCGG + Intronic
1004014562 6:11720256-11720278 CTGGAGAAAGGCTCACTAGTAGG + Intronic
1004509920 6:16277129-16277151 CGGGGGGAAGGCGCCTTCGTGGG + Intronic
1005468964 6:26143143-26143165 CAGGAGAAAGGCTCTGTGGTAGG - Intergenic
1007842108 6:44725079-44725101 CTGGAGAAAGTCACCTTCCCAGG - Intergenic
1007953619 6:45896421-45896443 CTTGAGCAAGGCTCCTTTCTGGG - Intergenic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1009486728 6:64233783-64233805 CTGGAGAAAGACACCTTGATAGG + Intronic
1013162743 6:107561475-107561497 ATGGAGAAAGCCTCCTCAGTCGG - Intronic
1013377107 6:109528108-109528130 CTGGAGAAGGGATACTGCGTAGG + Intronic
1014884877 6:126767621-126767643 GTGGAGAAGGACTCCTTGGTAGG - Intergenic
1019927225 7:4201279-4201301 CTGGAGACAGGCTCCATTCTGGG - Intronic
1020201207 7:6081498-6081520 CTGGAGAAGGGCTACTTCCGGGG - Intergenic
1021010798 7:15462958-15462980 CTGGGCAAAGGGTCCTTCCTGGG - Intronic
1022114186 7:27248293-27248315 AGGGAGGAAGGCTCCTTGGTTGG + Intergenic
1027451499 7:78336487-78336509 CTGAAGCAAGGCTCCTGCCTTGG - Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031158949 7:118143244-118143266 TTGGAGAAAAGTTCCTTCATGGG - Intergenic
1032019873 7:128401382-128401404 CTGGGGAAAGCCTCTTTCCTGGG + Intronic
1036658546 8:10692986-10693008 CTGGAGAAAGACTCCATCGGGGG + Intronic
1036847261 8:12178614-12178636 CTGGGGAAAGGATCCCTCCTAGG + Intergenic
1036868626 8:12420935-12420957 CTGGGGAAAGGATCCCTCCTAGG + Intergenic
1039902799 8:41765593-41765615 CTGGAGAAAGCCTTCTGCCTGGG + Intronic
1042705753 8:71664425-71664447 CTGGGCAAAGGCTCCTTCTTTGG - Intergenic
1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG + Intergenic
1046528705 8:115415574-115415596 CTGGAGACAGGGTCCTTAGTAGG + Intronic
1049876682 8:145027793-145027815 CTAGAGAAAGGCACCCACGTTGG + Intergenic
1052361105 9:27559290-27559312 AGGGAGAAAGGCTCCATAGTTGG - Intronic
1052831576 9:33220461-33220483 CTGGAGACAGATTCCTTGGTTGG - Intronic
1056320224 9:85428816-85428838 CTGGAGAACGTCTCCCTTGTTGG - Intergenic
1057938747 9:99262248-99262270 CTGGAGAATGTCTCTTTCCTTGG - Intergenic
1058141782 9:101364084-101364106 GTGGAGAATGGCTCCTGTGTAGG - Intronic
1058818208 9:108704868-108704890 CCTGGGAAAGGCTCCTTGGTTGG - Intergenic
1060235050 9:121856949-121856971 CTGGAGACAGCCACCTTCTTAGG - Intronic
1061154744 9:128851246-128851268 CTGGAGAAAGGCCCCATATTGGG - Intronic
1062530174 9:136996245-136996267 CTGGAGGAGAGCTCCTTGGTGGG - Intronic
1203424962 Un_GL000195v1:29380-29402 CTGGAGAAACCCTCCTTCTGGGG + Intergenic
1185792143 X:2935243-2935265 CTGGAGAATGGCATCTTCATAGG + Intronic
1186648407 X:11532513-11532535 CTGGAGAAAGGATCTTGCATGGG - Intronic
1190278420 X:48913914-48913936 TGGGAGGAAGGCTCCTTTGTAGG + Exonic
1190814893 X:53921247-53921269 CTGGAGAAAGGCTATTTTTTTGG + Intergenic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1195171540 X:102273383-102273405 CTGGAGAAACGGTCCTACTTTGG - Intergenic
1195187320 X:102413716-102413738 CTGGAGAAACGGTCCTACTTTGG + Intronic
1195667426 X:107443707-107443729 CTGTAGAAAGGCTGATTCCTGGG - Intergenic
1199255609 X:145715583-145715605 CTGGAGTAAAGCTCCTTGGCTGG - Intergenic
1199331708 X:146568118-146568140 CAGGAGAAATGCGCCTTGGTGGG + Intergenic
1201327588 Y:12780933-12780955 CTGGAAAATGGCTCATTTGTAGG - Intronic