ID: 998338172

View in Genome Browser
Species Human (GRCh38)
Location 5:141392928-141392950
Sequence ACGGACAAAGGCTCCTTCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998338172 Original CRISPR ACGGACAAAGGCTCCTTCGT GGG Exonic
901287122 1:8089591-8089613 GAGGACAGAGGCTGCTTCGTGGG + Intergenic
922473658 1:225891265-225891287 AGGGACAAAGGGTCCTTCCCAGG - Intronic
1067358036 10:45549391-45549413 ACTTACAAAGGCTGCTTCGCTGG + Intronic
1067406562 10:46029250-46029272 AAGGACAAAGGCTCCCTGGAAGG + Intronic
1075297487 10:121291245-121291267 AAGGACAGAGGCACCTTCTTTGG - Intergenic
1075544747 10:123346559-123346581 AGGGCCAAAGGTTCCTTCCTTGG + Intergenic
1078622242 11:12919430-12919452 ACTGACAAAACCTCCTTTGTTGG + Intronic
1098374132 12:69795207-69795229 CCTGGCAAAGGCTCCTGCGTAGG - Exonic
1103554502 12:121758118-121758140 ACTGACAAAGGCTCTGTCTTTGG - Intronic
1111760258 13:92454703-92454725 GAGGACAAAGGCTCCATCTTTGG - Intronic
1115454556 14:33586996-33587018 ACAGACAAAAGCTCCTTGTTTGG - Intronic
1122902153 14:104786408-104786430 ACGGGCACAGGCTCCTTCCGGGG + Intronic
1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG + Intronic
1203166884 17_GL000205v2_random:105603-105625 AGTGACAAAGGCTCCTTCTATGG - Intergenic
1161580520 19:5078164-5078186 ATGGACAAAGGCTTCTCCATGGG - Intronic
1166919798 19:46221423-46221445 ACAGACACAGGCTGCTTCTTTGG + Intergenic
927146171 2:20168033-20168055 ACTAACAAAGCCTCCTCCGTGGG + Intergenic
936269912 2:111041642-111041664 ATGGCCAAAGGCTGCTTCCTGGG - Intronic
1168956374 20:1837186-1837208 ACGGAGAAATGCTCATTCCTTGG + Intergenic
1171248127 20:23629623-23629645 AAGTCCAAAGGCTCCTTTGTGGG - Intronic
1173765970 20:45609644-45609666 ACAAATAAAGGCTCCTTAGTGGG - Intronic
1176334675 21:5584954-5584976 AGTGACAAAGGCTCCTTCCATGG + Intergenic
1176393082 21:6235994-6236016 AGTGACAAAGGCTCCTTCCATGG - Intergenic
1176404871 21:6353494-6353516 AGTGACAAAGGCTCCTTCTATGG + Intergenic
1176432286 21:6635610-6635632 AGTGACAAAGGCTCCTTCTATGG - Intergenic
1176468337 21:7080180-7080202 AGTGACAAAGGCTCCTTCCATGG + Intronic
1176491898 21:7461958-7461980 AGTGACAAAGGCTCCTTCCATGG + Intergenic
1176508744 21:7676425-7676447 AGTGACAAAGGCTCCTTCCATGG - Intergenic
954236501 3:49261154-49261176 AAGAACAAAGGCTCCTGCTTTGG - Intergenic
955185533 3:56711657-56711679 AGGGACAAAGACTGCTTCCTGGG + Intergenic
969484993 4:7467254-7467276 ACGGACAAAGGCAGCAGCGTGGG - Intronic
976888546 4:90015725-90015747 TCGTACAAAGGCTCCATGGTGGG - Intergenic
979838443 4:125404816-125404838 AAGGACAAATGCTGCTTGGTAGG - Intronic
985788647 5:1913332-1913354 ACAGACAACGGGTCCTTAGTGGG + Intergenic
991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG + Intergenic
996516240 5:124372688-124372710 ACAAACAAAGACTCCTCCGTAGG + Intergenic
998331367 5:141330799-141330821 ACAGACAAAGGTTCCTTCGTAGG + Exonic
998332195 5:141339086-141339108 ATCGACAGAGGCTCCTTCGTAGG + Exonic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
998337094 5:141383014-141383036 ACGGACAAAGGGTCCTTTGTGGG + Exonic
998338172 5:141392928-141392950 ACGGACAAAGGCTCCTTCGTGGG + Exonic
998341422 5:141421345-141421367 ACCGAAAAGGGCTCCTTCGTGGG + Exonic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1014499613 6:122169902-122169924 ACGGAGCAAGACTCCTTCTTGGG - Intergenic
1022114186 7:27248293-27248315 AGGGAGGAAGGCTCCTTGGTTGG + Intergenic
1030652844 7:112133789-112133811 AAGGACAAAGACTGCTTCTTTGG + Intronic
1042705753 8:71664425-71664447 CTGGGCAAAGGCTCCTTCTTTGG - Intergenic
1052361105 9:27559290-27559312 AGGGAGAAAGGCTCCATAGTTGG - Intronic
1061397160 9:130349460-130349482 ACAGACAAAGGCCCCGTGGTAGG + Intronic
1203439252 Un_GL000195v1:173102-173124 AGTGACAAAGGCTCCTTCTATGG + Intergenic
1190473873 X:50809178-50809200 ACTCACAAAGGGACCTTCGTGGG - Intronic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1198023393 X:132681118-132681140 AATTACAAAGGCTCCTTGGTGGG - Intronic
1200213422 X:154356899-154356921 AGGCACAAGGGCTCCTGCGTGGG - Intronic