ID: 998340470

View in Genome Browser
Species Human (GRCh38)
Location 5:141413302-141413324
Sequence TTAGAGAAAGGCTCTTTCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998340464_998340470 8 Left 998340464 5:141413271-141413293 CCGGCAGATCTCCTACTCAATTC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 998340470 5:141413302-141413324 TTAGAGAAAGGCTCTTTCGTGGG 0: 1
1: 0
2: 0
3: 14
4: 118
998340462_998340470 25 Left 998340462 5:141413254-141413276 CCATGGGAGGCTGGAGCCCGGCA 0: 1
1: 0
2: 3
3: 56
4: 313
Right 998340470 5:141413302-141413324 TTAGAGAAAGGCTCTTTCGTGGG 0: 1
1: 0
2: 0
3: 14
4: 118
998340466_998340470 -3 Left 998340466 5:141413282-141413304 CCTACTCAATTCCTGAGGAATTA 0: 1
1: 0
2: 0
3: 19
4: 170
Right 998340470 5:141413302-141413324 TTAGAGAAAGGCTCTTTCGTGGG 0: 1
1: 0
2: 0
3: 14
4: 118
998340463_998340470 9 Left 998340463 5:141413270-141413292 CCCGGCAGATCTCCTACTCAATT 0: 1
1: 0
2: 0
3: 7
4: 135
Right 998340470 5:141413302-141413324 TTAGAGAAAGGCTCTTTCGTGGG 0: 1
1: 0
2: 0
3: 14
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998340470 Original CRISPR TTAGAGAAAGGCTCTTTCGT GGG Exonic
905738160 1:40345365-40345387 TTAGAGACAGGGTCTTGCCTAGG - Intronic
907681477 1:56568363-56568385 TTAGAGAAAGGGTTTTTCCTGGG - Intronic
910392271 1:86757436-86757458 ATTGCGAAAGGCTTTTTCGTGGG - Intergenic
911575018 1:99565295-99565317 ATAGAGAAAGCCTCTTTCAAAGG + Intergenic
1065496010 10:26328673-26328695 TTGGATACAGGCTGTTTCGTAGG - Intergenic
1065946050 10:30606369-30606391 TTAGAGATAGGGTCTTTCTCTGG + Intergenic
1067404256 10:46006793-46006815 ATAGGGAAAGGCTGTTTGGTGGG - Intronic
1071783408 10:88872697-88872719 TTAGAGAAAGGGTTTTTAGGAGG + Intergenic
1079028055 11:16964491-16964513 TGAGGGAAAGGCTGTTTCCTAGG - Intronic
1080696826 11:34609948-34609970 GTAGGTAGAGGCTCTTTCGTAGG + Intergenic
1086855875 11:91865213-91865235 TAACAGAAAGGCTCATTCCTGGG - Intergenic
1087323855 11:96697351-96697373 TTAGAGACAGGTTCTTTCCTGGG - Intergenic
1094004548 12:25735036-25735058 TCAGAGAAAGCCTCTTTGGTGGG - Intergenic
1096362658 12:51001532-51001554 ATAAAGAAAGGCTATTCCGTAGG - Intronic
1098039249 12:66337406-66337428 TTAGGAAAAGGGTCTTTCTTTGG - Intronic
1103297129 12:119897154-119897176 TTAGAAAAAGGCTCTTTGAATGG - Intergenic
1103449444 12:121018151-121018173 TTAGTGAAAGGGTCTTGTGTTGG + Intergenic
1103829934 12:123770765-123770787 TTAGAGAAAGGAGCTTTCCCTGG - Intronic
1106082194 13:26509695-26509717 TTAGAGAAAGGCACCCACGTTGG - Intergenic
1109425607 13:62163249-62163271 TTACAGAATCGCTCTTTTGTTGG - Intergenic
1111256719 13:85679243-85679265 TTAGAGAATACCTCTTTCCTTGG - Intergenic
1114197253 14:20489750-20489772 TTAGAGAAAGAATCGTTTGTGGG + Intergenic
1114668437 14:24395937-24395959 TTAAAGAATGGCTCTTTTATGGG - Intergenic
1115465021 14:33705955-33705977 TTAGAGAATGCATTTTTCGTTGG - Intronic
1116658337 14:47676676-47676698 TGAAAGACAGGCTCTTTTGTTGG + Intergenic
1118841897 14:69519776-69519798 TTAGAGAAAGGGACTTTCCAGGG + Intronic
1119245930 14:73108208-73108230 TTAGAGACAGGGTCTTACCTCGG + Intronic
1120212057 14:81642935-81642957 TTAGAGATAGGGTCTTTAGGAGG + Intergenic
1124396601 15:29307617-29307639 TTAGAGATAGGGTCTTTAGTAGG + Intronic
1124900198 15:33815388-33815410 TTCGAGCTAGGCTCTTTCGAAGG - Intronic
1127676959 15:61248701-61248723 TAAGAGAAAGGCAGTTTCATTGG + Intergenic
1128194601 15:65740776-65740798 GTAGAGACAGGGTCTTTCTTAGG - Intronic
1128426922 15:67551351-67551373 TTAGAGACAGGATCTTGCCTTGG + Intronic
1130121043 15:81047848-81047870 TTAGAAAAGGCCTCTTTTGTTGG - Intronic
1132070010 15:98768118-98768140 GTGGAGAAAGGCTTTTTAGTTGG - Intronic
1134771050 16:16809876-16809898 TTAGAGATAGGCTCTTTACAGGG - Intergenic
1146067067 17:29644359-29644381 TTAGAGAAAGGCACTTTCAGAGG - Intronic
1147538850 17:41339804-41339826 TTAGAGAAAGGCTCTCTCTCTGG - Intergenic
1148701640 17:49590642-49590664 TTTGACACAGGCTCTTTCCTGGG + Intergenic
1150088985 17:62303469-62303491 TTAGAGATAGGGTCTTTAGAAGG - Intergenic
1151886203 17:76924637-76924659 TTAGAGAAAGGCTCCCTCTCTGG + Intronic
1154173329 18:12066797-12066819 AGAGAGAAAGGCTCTTTGGGGGG - Intergenic
1159042699 18:63339978-63340000 TAAGAGAAAGGCTGTTTTGAAGG + Intronic
1162090825 19:8278835-8278857 TTAGAGACAGGGTCTTGCTTTGG - Intronic
1162093058 19:8293673-8293695 TTAGAGACAGGGTCTTGCTTTGG - Intronic
1163635272 19:18434473-18434495 AGAGAGAAAGGCTCTTTGGGGGG + Exonic
1167210342 19:48130363-48130385 AAAGAGAAAGGCTCTTTGATAGG + Intronic
926806669 2:16717477-16717499 TTAGAGATAGGCCCCTTCCTGGG + Intergenic
927901927 2:26826471-26826493 TTAGAGAGAGGCTATATCTTTGG - Intergenic
929196015 2:39185067-39185089 TTAAAGAAAGACTCTCTAGTAGG + Intronic
933345670 2:81082410-81082432 TTAAAGATAGGCTTTTTCTTGGG + Intergenic
935720014 2:105971732-105971754 GTAGAGAAAGGCTCTTGCTGGGG - Intergenic
936470827 2:112797381-112797403 TTGGAGGAAGGCTCTTTGGGAGG - Intergenic
940690152 2:156907017-156907039 TAAGAGAATGGCTTTTTCCTTGG + Intergenic
940757080 2:157695646-157695668 TTAGACAAATGCTCTTGTGTGGG + Intergenic
941018466 2:160383471-160383493 TTAGAGAAAGCCACTGTAGTGGG - Intronic
943773897 2:191744266-191744288 GTAGAGAAAGTCTCTTTCCAGGG - Intergenic
945728036 2:213497483-213497505 TTATGGAAAGGCTTTATCGTTGG + Intronic
947679780 2:232019906-232019928 TTAGAGAGAGCCTCTTTAGTAGG + Intronic
1171440535 20:25157929-25157951 TTAGAGATAGGGTCTTTAGAAGG + Intergenic
1174022549 20:47542652-47542674 TTAGAGAGAGGGTCTTGCCTAGG - Intronic
1175067032 20:56297841-56297863 GTGCAGAAAGGCTCTTTCGGAGG + Intergenic
1178387538 21:32165513-32165535 GTAAAGAAAGGCACTTTCTTAGG + Intergenic
1178639066 21:34331379-34331401 TAAGAGAAAGGATATTTCCTTGG + Intergenic
1183211811 22:36455673-36455695 TTAGAGAAAGGCACCTGCTTGGG - Intergenic
1185131522 22:49041931-49041953 CCTGAGAAAGGCCCTTTCGTGGG - Intergenic
949186328 3:1196311-1196333 TTTGAGTAAGGCTCTTCAGTTGG + Intronic
950956962 3:17064047-17064069 TAAGAGAAGGACTTTTTCGTTGG + Intronic
952387036 3:32849322-32849344 TTAGAGGAAGGATCTTGCATAGG + Intronic
952571663 3:34725120-34725142 TTACAGTAAGGCTCTTTCAGTGG - Intergenic
954776862 3:53027239-53027261 TTTGAGAAAGGATTTTTTGTAGG - Intronic
955257837 3:57352685-57352707 TTAGTGTAAGGCTCTATGGTAGG + Intronic
955976600 3:64486019-64486041 GCAGAGAAAGGCTCTTTCAAAGG - Intergenic
957000670 3:74880154-74880176 TCAGGGAAAAGCTCTTTCCTAGG + Intergenic
957240698 3:77657588-77657610 TTAGAGATAAGATCTTTCCTGGG - Intergenic
957714145 3:83903233-83903255 TGAGAGAAATGCTCTTAAGTGGG - Intergenic
958061167 3:88483321-88483343 TTAGAGAAAGGCACAGTCTTTGG + Intergenic
963549810 3:146705088-146705110 TTAGAGACAGGGTCTTGCTTTGG + Intergenic
963682924 3:148403335-148403357 TTAGAGAAAGGCTTCTTCTCTGG - Intergenic
964860993 3:161200812-161200834 TTGAAGAAAGGCTCTTTACTAGG + Intronic
966669570 3:182512009-182512031 TTAGAGAAAGGTTTCTTCATGGG + Intergenic
967365757 3:188684832-188684854 TTAGCCAAAGACTCTTTTGTTGG + Intronic
967950410 3:194835999-194836021 TTAGAGGAAGGCTCTGTGGAAGG + Intergenic
970135080 4:12913358-12913380 TTAGAAAAGGGCTCTTTCTGAGG + Intergenic
971878430 4:32335800-32335822 ATAGAGAAAGTCTCTTTCTCTGG - Intergenic
972183492 4:36498950-36498972 TTAGAGAAGGGCTCTTCCGAAGG - Intergenic
977168755 4:93733612-93733634 TTTGAGGAAGTCTCTTTCCTTGG - Intronic
979447710 4:120834284-120834306 TTAGAGGGAGGCTCTTTGGGAGG + Intronic
982580351 4:157169938-157169960 TTAGAGAAAGTCTGTCTCATTGG + Intronic
986396721 5:7338008-7338030 TTAGAGGGAGGCTCTTTCATGGG - Intergenic
988922057 5:35952552-35952574 TTAGAGAAAGGCTATGTTCTGGG + Exonic
989432193 5:41368885-41368907 TTATAGAAAGGCTGTTTCAATGG - Intronic
992182776 5:74214312-74214334 TTAGAGCAAGGATCTGTGGTTGG + Intergenic
994611263 5:102044014-102044036 TTACAGAAAAGCTCTTTCAGAGG + Intergenic
995764775 5:115602844-115602866 TGAGAAAAAGGATCTTTCGCAGG - Intronic
995805412 5:116046854-116046876 TTAGAGATAGGGTCTTTGGGAGG + Intronic
998332755 5:141344148-141344170 CTAGATAAAGGTTCCTTCGTGGG + Exonic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
998340470 5:141413302-141413324 TTAGAGAAAGGCTCTTTCGTGGG + Exonic
1007320156 6:41022322-41022344 TTATAGAAAAGTTCTTTAGTGGG - Intergenic
1008085817 6:47242914-47242936 TTATCGAAAGGCTTTTTTGTGGG - Intronic
1016142025 6:140625026-140625048 TTAATGAAAGACTCTTTCATAGG + Intergenic
1016452088 6:144193947-144193969 TTAGAGAGAGGGTCTTGCCTAGG + Intergenic
1017200678 6:151751183-151751205 TTAGGGAAAGGCTCTGTACTGGG + Intronic
1018997485 6:168721089-168721111 TTAGAGAAAGGCACTCTCTTTGG - Intergenic
1019945978 7:4329674-4329696 TTAGAGATAGGATCTTTCTCTGG + Intergenic
1022041164 7:26582789-26582811 GTAGAGAAGGGCTCTTTTATGGG - Intergenic
1027883960 7:83879091-83879113 TTAGAGAAAGGCATATTCTTTGG - Intergenic
1030543319 7:110861291-110861313 TTGGAGACAGGGTCTTGCGTCGG + Intronic
1031952493 7:127906637-127906659 TTAGGGATAGGCTCTCTCCTTGG + Intronic
1032820207 7:135517520-135517542 TTAGAGACAGGGTCTTGCCTAGG + Intergenic
1034307071 7:150052497-150052519 TTAGAGAAAGGCTATTTATTGGG - Intergenic
1034799777 7:154048185-154048207 TTAGAGAAAGGCTATTTATTGGG + Intronic
1037909145 8:22733434-22733456 TTAGGTAAAGGCTCTTTGGCTGG + Intronic
1038667571 8:29553235-29553257 TTAAAGAAAGGCTCTTATTTTGG - Intergenic
1042266678 8:66915676-66915698 TTAGAGAAAAGCTCTAACCTAGG + Intronic
1043328245 8:79080284-79080306 ATAGAGAAAGGTTCTTCCTTGGG + Intergenic
1043699101 8:83261620-83261642 TTGGTTAAAGGCTCTTTTGTTGG - Intergenic
1044656318 8:94552508-94552530 TTAGAGAACTGTTCTTTCTTTGG - Intronic
1045776837 8:105814321-105814343 TTGGAGGAAAGCTCTTTTGTTGG + Intergenic
1047092465 8:121589076-121589098 AGAGAGAAATGCTCTTTCTTGGG + Intergenic
1047921044 8:129634793-129634815 CTAGAGAGAGGCTCTATCATGGG - Intergenic
1050823575 9:9914493-9914515 TGAGAGAAAGGCTGTTTGGCTGG - Intronic
1052272758 9:26643680-26643702 TTAGAGCAAGACTCTGTCATAGG - Intergenic
1055468719 9:76590869-76590891 TTAGAGAAAGGCTCTGGGGCAGG - Intergenic
1060684646 9:125597788-125597810 TCAGAGAATGGCTCTTTTGAAGG - Intronic
1062468015 9:136689998-136690020 TTAGAGAAAATCTCTTTTCTAGG - Intergenic
1186162073 X:6788049-6788071 ATAGAGAAAGTCTCTCTCTTAGG + Intergenic
1188923009 X:36002279-36002301 GTAGAGAGAAGCTCTCTCGTTGG - Intergenic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1195508880 X:105691070-105691092 TTAGAGATAGGCTCTTTTGGAGG - Intronic
1196066043 X:111465429-111465451 TAGGAGAAAGGCTCTTCCCTTGG - Intergenic