ID: 998341065

View in Genome Browser
Species Human (GRCh38)
Location 5:141418508-141418530
Sequence GGTGGGGACCCTCCCCGAAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998341058_998341065 2 Left 998341058 5:141418483-141418505 CCACTTGGTACTGACCGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 998341065 5:141418508-141418530 GGTGGGGACCCTCCCCGAAGCGG 0: 1
1: 0
2: 0
3: 8
4: 107
998341056_998341065 23 Left 998341056 5:141418462-141418484 CCGAGAAACGCAGAGCGCTCACC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 998341065 5:141418508-141418530 GGTGGGGACCCTCCCCGAAGCGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998341065 Original CRISPR GGTGGGGACCCTCCCCGAAG CGG Exonic
900184768 1:1327928-1327950 GGTGGCGACCAGCCCAGAAGAGG + Exonic
900390741 1:2432793-2432815 GTTGGGGACCCTCCCTGCTGTGG - Intronic
900393989 1:2445623-2445645 GGTAGGGACCCTGCCCAGAGGGG + Intronic
900553255 1:3267374-3267396 GGTGTGGCCCCTCCACGCAGGGG - Intronic
904745612 1:32708959-32708981 GGTGGGGACCCTGCCTGGAGTGG - Intergenic
905272129 1:36794018-36794040 GGTCGGGACCATCCCTGGAGAGG - Intergenic
911666493 1:100558603-100558625 GGTGGGGAGACTCCCAGGAGTGG - Intergenic
912384728 1:109265636-109265658 GGTCGGGACCCTCTCCACAGGGG + Intronic
912796824 1:112698503-112698525 GGTGGGGCCCCTCCCCCAGATGG + Intronic
920156256 1:203954470-203954492 AGTGGAGCCCCTCCCTGAAGTGG - Intergenic
1072834513 10:98696584-98696606 GGTTGGGACCCTCGCCCCAGTGG - Intronic
1075463085 10:122631733-122631755 CCTGGGGACCCTCGCCGAGGGGG + Intronic
1081646257 11:44792690-44792712 AGTGGGGTTCCTCCCGGAAGAGG + Intronic
1083876386 11:65526256-65526278 GGTGGGGGACCTCCCCGCAAGGG + Exonic
1084358888 11:68657025-68657047 TGCTGGGACCCTCCCAGAAGGGG + Intergenic
1084585849 11:70061852-70061874 GGTAGAGACCCTCCCCTAATTGG - Intergenic
1088813010 11:113404180-113404202 GATGGGGACCCTGCCCTATGGGG + Intergenic
1089385979 11:118068318-118068340 GGAGGGCTCCCTCCCCGAGGAGG - Intergenic
1089773526 11:120819995-120820017 GCTGGAGACCCTCCAGGAAGGGG + Intronic
1091623219 12:2105577-2105599 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623237 12:2105630-2105652 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623255 12:2105683-2105705 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623272 12:2105736-2105758 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623290 12:2105789-2105811 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623324 12:2105895-2105917 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623342 12:2105948-2105970 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623361 12:2106002-2106024 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623455 12:2106322-2106344 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623472 12:2106375-2106397 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623508 12:2106482-2106504 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623554 12:2106641-2106663 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623573 12:2106695-2106717 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623635 12:2106907-2106929 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623654 12:2106961-2106983 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623706 12:2107123-2107145 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623769 12:2107356-2107378 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1091623800 12:2107463-2107485 GGTGGAAACCCTCCCCGGGGTGG - Intronic
1095946698 12:47757982-47758004 GGTGGGAGCCCTCCCTGACGTGG - Exonic
1102490647 12:113287921-113287943 GGCGGGGTCCTTCCACGAAGAGG - Intronic
1104679051 12:130736749-130736771 GATGTGGACCCTCCCTGAGGAGG - Intergenic
1113017013 13:105838814-105838836 GTTGGGGACGCTCCTCGGAGAGG - Intergenic
1119172193 14:72544088-72544110 GGTGGGGGGCCTCACCAAAGAGG + Intronic
1121151257 14:91637185-91637207 GGTAGGGACCATCCCCAAAGGGG + Intronic
1121329295 14:93040012-93040034 GGTGGGGTGCCTCCCAGCAGGGG - Intronic
1122278504 14:100607839-100607861 GCTGGGGACCCTCCAAGCAGTGG - Intergenic
1127977713 15:64010578-64010600 GGTGGGGACTTTGCCTGAAGTGG - Intronic
1128833377 15:70789489-70789511 GGTGGGAACCCACCCTGGAGAGG - Intergenic
1129028886 15:72604603-72604625 GGTAGGGACCCTCTAGGAAGGGG + Intergenic
1131229540 15:90649662-90649684 CGTGGGGACCCTTCCCAGAGGGG - Intergenic
1134014453 16:10878734-10878756 GCCTGGGACTCTCCCCGAAGTGG + Intronic
1135091193 16:19519231-19519253 GGTGGGGTCCCTCTCTGAGGAGG + Intronic
1136382420 16:29901680-29901702 GGTGGGGACCAGCCCCGAGGCGG - Exonic
1137272149 16:46908903-46908925 GGTGGAGACTCTCCCTGCAGAGG + Intronic
1138195396 16:55048128-55048150 GCTGGGGACCCTTCCCCGAGGGG - Intergenic
1138490491 16:57373498-57373520 GGTGGGGGCACTCCCTGAGGAGG - Intronic
1142148520 16:88502616-88502638 GGTGGGGACCCTCGGCTAGGGGG - Intronic
1142704223 17:1684385-1684407 GGTGGGGACCCTCCCCGTTTGGG - Intronic
1143681583 17:8480018-8480040 GGTGGGGAGCCCCCCCGAAAGGG + Intronic
1148710554 17:49677860-49677882 GGGGGGGCACCTCCCTGAAGAGG - Intronic
1151551095 17:74822918-74822940 CGTGGGGTCCCTCCCCCAAAAGG - Intronic
1152344589 17:79743271-79743293 GGGGGGGACCCTCCCTGGACAGG + Intergenic
1152645435 17:81466530-81466552 GGTGGGGTCCCTCCAGGAGGAGG + Intergenic
1153503447 18:5771262-5771284 GGTTGAGACCCTCCCCAGAGAGG - Intergenic
1160184058 18:76660900-76660922 GGTGGGGCCCCGCCCTGGAGGGG + Intergenic
1160619051 18:80157670-80157692 GGTGCGGATCCTCACCGGAGAGG + Exonic
1160704166 19:521846-521868 TCTTGGGACCCTCCCCAAAGAGG - Intergenic
1160774767 19:850400-850422 GGTGGGAACCCTGCCAAAAGGGG + Intergenic
1161297360 19:3526674-3526696 GGTGGGGGTCCTGCCCGTAGGGG + Intronic
1161365357 19:3876157-3876179 GGTGGTGATCCTGCCCGCAGCGG - Intergenic
1163518212 19:17777659-17777681 GGTTGGGAACCTCCCTGAGGGGG + Intronic
1165006134 19:32808664-32808686 GGTGGTGACTCTCCCAAAAGAGG - Intronic
1166043925 19:40218424-40218446 GGTGGGGACCAGCCCCGCGGGGG - Intergenic
1167146243 19:47681993-47682015 GGTGGGGGCCCTCTGCGGAGAGG - Exonic
1167781496 19:51601681-51601703 GGTGGGGACGGTCTCGGAAGTGG - Intergenic
1168130127 19:54312484-54312506 GGTGGGGTCCCTCCCAGACTAGG + Intronic
926365568 2:12129964-12129986 GGTCGGGAGTCTCCCAGAAGAGG - Intergenic
928365319 2:30695972-30695994 GGTGGGGACCCTTCCTGGAGGGG + Intergenic
933800829 2:85959061-85959083 GGTGGGGACCCGCCCTGGACAGG - Intergenic
942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG + Intergenic
945974201 2:216258174-216258196 GTTTGGAACCCTCCCCAAAGAGG - Exonic
1171459163 20:25288926-25288948 GGTGGGGACACTGGCCGCAGAGG - Intronic
1176179632 20:63743158-63743180 GGTGGGACCCCTCCCCGACCTGG - Exonic
1178955518 21:37018138-37018160 GGAGCGGACCCTCCCCCCAGTGG - Exonic
1179603539 21:42496783-42496805 GGTGGGCAGCATCCCCGGAGGGG - Intronic
1181395306 22:22617074-22617096 GTTGGGGCGCCTCCCTGAAGAGG - Intergenic
950446557 3:13042171-13042193 GACGGGGACCCTCCGCCAAGAGG + Intronic
950729687 3:14947237-14947259 GGTGGGGACCGTCCTCGCAGTGG - Intergenic
950956381 3:17057945-17057967 GATATGGACCCTCCCCTAAGAGG + Intronic
979231430 4:118352666-118352688 GTTAGGGGCGCTCCCCGAAGTGG - Exonic
979942521 4:126779709-126779731 GGCGGGGCCCCTCTCTGAAGCGG - Intergenic
980988352 4:139717468-139717490 GCTGGGCGCCCTCTCCGAAGAGG - Exonic
985555358 5:555423-555445 GGTCGGGCCCCTCCCCCAGGGGG - Intergenic
992432048 5:76718942-76718964 GCTGGGGACCCTCCTGCAAGGGG - Intronic
998333559 5:141350900-141350922 GGCGGGGACCCGCCTCTAAGCGG + Exonic
998341065 5:141418508-141418530 GGTGGGGACCCTCCCCGAAGCGG + Exonic
1001997694 5:176175155-176175177 AGTGGGGAAAATCCCCGAAGAGG - Intergenic
1002197441 5:177509096-177509118 GGTGGAGCCCCTCCCTGCAGCGG - Intronic
1002304767 5:178276614-178276636 GGTGCTGACCCGCCCTGAAGGGG - Intronic
1006401856 6:33822369-33822391 ACTGGGGCTCCTCCCCGAAGAGG + Intergenic
1007405631 6:41634630-41634652 GAATGGGACCCTCCCGGAAGAGG - Intergenic
1011277430 6:85643728-85643750 GGTGGGTGCCCTCCGGGAAGCGG - Intronic
1017040505 6:150304801-150304823 GGTGGGCTCCCTCCCAGTAGTGG - Intergenic
1018943679 6:168329427-168329449 GATGGGAGCCCTCCCGGAAGAGG - Intergenic
1018943701 6:168329509-168329531 GATGGGAGCCCTCCCAGAAGAGG - Intergenic
1018943763 6:168329775-168329797 GACGGGAACCCTCCCAGAAGAGG - Intergenic
1026896688 7:74013593-74013615 GCTGGAGACCCTCCCCCCAGGGG + Intergenic
1030735353 7:113041689-113041711 GGTGGGTACCCTACCACAAGTGG - Intergenic
1034434198 7:151055376-151055398 GGAGGAGACCCCCCCCGAAAGGG + Intronic
1037922464 8:22817041-22817063 TTTGAGGACCCTCCCTGAAGAGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1039800625 8:40951726-40951748 GGTGGGGACCCCTCCAGAAAGGG - Intergenic
1056592446 9:87974401-87974423 CGTGGGCGCCCTCCCCGATGCGG + Exonic
1060527043 9:124326604-124326626 GGTCAGGAACCTCCCCGAGGTGG + Intronic
1062501549 9:136854100-136854122 GGTGGGGGCCCTCCCGGGGGTGG - Intronic
1186221660 X:7355707-7355729 GGTGGGGACTCTCACCATAGAGG - Intergenic
1195065212 X:101233674-101233696 GGTAGGGCCCCTCCTGGAAGTGG - Intronic