ID: 998341286

View in Genome Browser
Species Human (GRCh38)
Location 5:141420008-141420030
Sequence CAGTCTTTCAGCCCTACTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998341284_998341286 14 Left 998341284 5:141419971-141419993 CCTCGCGGTGATTCTAGCTATTG 0: 1
1: 0
2: 1
3: 1
4: 17
Right 998341286 5:141420008-141420030 CAGTCTTTCAGCCCTACTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998341286 Original CRISPR CAGTCTTTCAGCCCTACTGC AGG Exonic
900256053 1:1698831-1698853 CCGTCTTCCAGCCCTAACGCTGG + Intronic
900264721 1:1751441-1751463 CCGTCTTCCAGCCCTAACGCTGG + Exonic
901530735 1:9850972-9850994 CTGCCTTGCAGCCCTACAGCAGG - Intronic
902451186 1:16498198-16498220 CAGTCTTTCAGCCCTAGGAGGGG - Intergenic
905790223 1:40785490-40785512 CTGTCTAGCAGCCCTCCTGCTGG + Intronic
908273765 1:62447765-62447787 GAGTCTTTCAGAGCTACTGAGGG + Intronic
915630114 1:157147107-157147129 AATTCTCTCAGCCCTTCTGCAGG - Intergenic
916515868 1:165516131-165516153 CATTTTTTCACCCCTACAGCAGG - Intergenic
918348202 1:183625356-183625378 CAGTCTATCAGCTTTACTGAGGG - Intronic
920198426 1:204244745-204244767 CAGGCCTCCAGCCCTAGTGCTGG - Intronic
922456467 1:225777641-225777663 CACTCATTCAGCCCTACCGGGGG + Intergenic
923649839 1:235864179-235864201 CAGTCTCCCTCCCCTACTGCAGG + Intronic
1063487620 10:6434742-6434764 CAATCTGTCAGCACTACTGCTGG - Intronic
1065829411 10:29600779-29600801 CAGTCTTTCGGTCCTTCTCCTGG - Intronic
1067475316 10:46561125-46561147 CCCACTGTCAGCCCTACTGCAGG - Intergenic
1070641153 10:78171055-78171077 CAGTCTTCCAGTCTTACAGCAGG + Intergenic
1071718901 10:88123262-88123284 CAGCCCTGCAGCCCCACTGCAGG - Intergenic
1091001630 11:131914714-131914736 CACTCTTTCTGCCCTCCCGCTGG + Intronic
1094617854 12:32052336-32052358 CAGTCTTTCATTCCTAGTGCAGG + Intergenic
1095342454 12:41107549-41107571 CAGTCTAGCAATCCTACTGCTGG - Intergenic
1095565664 12:43621043-43621065 CAGTCTTTGGGCCCTAGTGGTGG + Intergenic
1097768106 12:63548512-63548534 CAATCTCTCTCCCCTACTGCAGG + Intergenic
1097812616 12:64035016-64035038 AACTCTTTCAGCCCTGATGCTGG + Intronic
1099604753 12:84789440-84789462 CAGTTTTTCAGCACTACCACTGG + Intergenic
1099917592 12:88915006-88915028 CAGTCTTTGGGCCCTAGTGGTGG + Intergenic
1100420682 12:94429942-94429964 CTGTGCTGCAGCCCTACTGCTGG - Intronic
1101587894 12:106101087-106101109 CAGTCTGTGAGCCCATCTGCTGG - Intronic
1101828439 12:108239098-108239120 CAGTCTTTCTGGTCTAGTGCTGG + Intronic
1102255685 12:111413574-111413596 GAGTCTTGAAGCCCAACTGCAGG - Intronic
1102957788 12:117070535-117070557 CAGTCTTCCTGCCCTGCTACTGG - Intronic
1104286401 12:127428605-127428627 AAATCCTTCAGCCCTAATGCTGG - Intergenic
1104317271 12:127715174-127715196 CTGTGTTTCAGTCTTACTGCTGG - Intergenic
1104345595 12:127993838-127993860 CAGTCTTTCCTCCCTGCTGCAGG + Intergenic
1107096927 13:36547149-36547171 AAGTCTTCCAGCCCCACAGCAGG - Intergenic
1107286660 13:38801699-38801721 CAGTCTTTGAGCCCCAGTGGTGG + Intronic
1108723129 13:53152211-53152233 CACTCTTTCAGCCACACTTCAGG - Intergenic
1111984901 13:95055974-95055996 CAGTCTTGCAGTCCTGCTGAGGG - Intronic
1113937175 13:114000626-114000648 GGGTCTTTCAGACCTGCTGCTGG - Intronic
1121197571 14:92087733-92087755 CATTCTTTAAACCCTACTGTGGG - Intronic
1129154045 15:73706688-73706710 CAGACTTTCAGTCCTCCAGCTGG + Intronic
1140660373 16:77185438-77185460 CCTTCTTTCAGCCCTACTATTGG + Intergenic
1142599617 17:1047234-1047256 CAGTCTTTCTGCCCGCCAGCAGG - Intronic
1145296039 17:21593298-21593320 CAGGCTTCCAGCCCTTCTGTGGG - Intergenic
1145795819 17:27654830-27654852 CGGCCTTCCAGCACTACTGCCGG + Intergenic
1146518917 17:33511137-33511159 GAGTCTTACAGCCATACAGCTGG - Intronic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1149065088 17:52469739-52469761 CAGTTTTTCTTCCCAACTGCTGG - Intergenic
1149267708 17:54945464-54945486 CAGTCTTTCTGCTCTCCTGCTGG + Intronic
1153410419 18:4786551-4786573 CCGTTATTCAGCCCTACAGCAGG - Intergenic
1154980163 18:21497220-21497242 CTGTCTTGCAGCATTACTGCAGG + Intronic
1156283555 18:35666819-35666841 CAGTCCTTCTGGCCAACTGCTGG + Intronic
1157210680 18:45739532-45739554 CAGTCTTTCAGCCCCATTTGAGG + Exonic
1159748287 18:72267935-72267957 CATTCTTTCAGCCTTACCTCTGG + Intergenic
1160702565 19:515000-515022 AAGGCTGTCAGCCCTGCTGCCGG - Intronic
1162253854 19:9471334-9471356 CAGTGTTTCAGCACTGCAGCAGG - Exonic
1164859899 19:31554696-31554718 CACCCTTTCATCCCCACTGCTGG + Intergenic
926113702 2:10197866-10197888 CAGACTTTCAGCACTGCTGCTGG + Intronic
932506755 2:72240996-72241018 CAGTTTTTCTGCCCTAGTACTGG - Intronic
936373428 2:111921542-111921564 CAGCCCTACAGCCCTTCTGCAGG - Intronic
940770598 2:157835720-157835742 CTGGTTTTCAGCCCTACTGTGGG - Intronic
943088811 2:183349703-183349725 CAGTCTCTCAGCTTTACAGCTGG + Intergenic
944677515 2:202046737-202046759 CAGTCTATCAGCCCAACAGGTGG - Intergenic
947939408 2:234036145-234036167 CAGTCTTTGGGCCCCACTGGTGG - Intergenic
1173699741 20:45058306-45058328 CACTCTGTAAGCCTTACTGCTGG - Intronic
1175858786 20:62138053-62138075 CAGTCATTAAGCATTACTGCTGG + Intronic
1176141939 20:63548669-63548691 CAGTCTCTCACTCCTCCTGCCGG + Intronic
1178470383 21:32887066-32887088 GAGACTCTCAGCCCTTCTGCAGG + Intergenic
1185025989 22:48412943-48412965 CAGTCTTTCAGCCCGCTTGCGGG - Intergenic
950556788 3:13700920-13700942 CTGACTCTCAGCCCCACTGCTGG - Intergenic
951170069 3:19531544-19531566 AACTATTTCTGCCCTACTGCTGG - Intronic
955798433 3:62661777-62661799 CTGTTTTCCAGCCCTACTACTGG - Intronic
956264597 3:67382783-67382805 AAGTATTTCAGCCCCTCTGCTGG + Intronic
958897739 3:99848411-99848433 CAGCCCTTCAGCACCACTGCAGG - Exonic
960535226 3:118808145-118808167 CAGTCTTTCTGCTATACTCCAGG + Intergenic
962756433 3:138468599-138468621 CAGTCTTTGTGTCCTGCTGCTGG + Intronic
963286137 3:143436233-143436255 CAGTGGTCCAGTCCTACTGCTGG + Intronic
963861501 3:150315046-150315068 CAGTCTTTGAGCCCCCTTGCGGG - Intergenic
965389368 3:168085736-168085758 CAGGCTTTGAGACCTACTACAGG + Intronic
966007555 3:175034687-175034709 CAGTCTTTGTCTCCTACTGCTGG + Intronic
968313239 3:197701194-197701216 CAGTCCTTCATACATACTGCAGG - Intronic
968558256 4:1261405-1261427 CCGTTTCTCAGCCCTACCGCTGG - Intergenic
970867485 4:20775843-20775865 GAGTCTTTCTGCCCTCCTGAAGG - Intronic
978635310 4:110797770-110797792 CTGTCTTTCAGCCTTACTTAAGG + Intergenic
978764611 4:112391323-112391345 CAGTGTTACAGCCAAACTGCAGG + Intronic
984705513 4:182844736-182844758 TGGTCTTCCAGCCCAACTGCAGG + Intergenic
986254525 5:6091159-6091181 CTGTCTTGCAGAACTACTGCTGG - Intergenic
988069427 5:26267389-26267411 CACAATTCCAGCCCTACTGCTGG + Intergenic
989016258 5:36938221-36938243 CAGTCTCTCAACCCTTCTCCCGG - Intronic
990120630 5:52446629-52446651 CATTCTTTCAGCATTAATGCTGG + Intergenic
992847408 5:80765012-80765034 CAGGAGTTCAGCCCTACTTCTGG - Intronic
993621047 5:90168142-90168164 CAGACTCTAAGCCCTACTGATGG + Intergenic
998341286 5:141420008-141420030 CAGTCTTTCAGCCCTACTGCAGG + Exonic
998752772 5:145340879-145340901 CAGTCTTTGGGCCCTAGTGGTGG - Intergenic
998810302 5:145959728-145959750 CAGTCCTTCAGCCCTCCTAGAGG - Intronic
999302884 5:150501999-150502021 CATTCTTTCAGCCCTGCCTCTGG - Intronic
999456923 5:151724583-151724605 CAGTCTTTCAGTCCTGCTCCTGG + Intergenic
1006445603 6:34078112-34078134 CATTCTTTCATCCCTATTGTTGG - Intronic
1007223995 6:40300136-40300158 CAGTGTGTCAGCTCCACTGCAGG - Intergenic
1008503751 6:52208990-52209012 CTGTCTTATAGACCTACTGCAGG + Intergenic
1017739166 6:157391220-157391242 CTGTTTTTCAGCCTGACTGCCGG + Intronic
1017812091 6:157990696-157990718 CAGTTTCTCACCCCTGCTGCTGG + Intronic
1019613333 7:1947813-1947835 CAGCCCTTCAGCCCTCCTGCTGG - Intronic
1020693165 7:11383551-11383573 CAGTCTTTATGCACTACTGATGG - Intronic
1022401860 7:30046276-30046298 CTGTCTTTCAGCCACACTTCTGG - Exonic
1023980023 7:45063958-45063980 CAGGATTTCAGTCCTACTGGAGG - Exonic
1025605553 7:63037826-63037848 CAGTCTTTCAGCCCACAGGCTGG + Intergenic
1025785233 7:64637917-64637939 AAGGCATTCAGCCCTATTGCTGG - Intergenic
1028506132 7:91572090-91572112 CATACTTTCAACCCTACAGCAGG + Intergenic
1029339223 7:99929434-99929456 CAGCCTTGCAGCCCGGCTGCTGG + Exonic
1029347969 7:99992564-99992586 CAGCCTTGCAGCCCGGCTGCTGG - Intergenic
1031537904 7:122957883-122957905 CAATGTTACAGCCCTACTTCAGG - Intergenic
1034520599 7:151616492-151616514 CTGTCTTCCAGAACTACTGCAGG + Intronic
1036221381 8:6923802-6923824 CAGTTCTTCTGCCCTTCTGCTGG - Intergenic
1037293661 8:17378448-17378470 CAGTAATTCAGCCTTACTGTTGG + Intronic
1039360180 8:36867874-36867896 CAGTCTGTCAGCCCTATTTCTGG + Intronic
1039475751 8:37838648-37838670 CAGTCCTGCAGGCCTGCTGCTGG + Intronic
1042603831 8:70526444-70526466 CATTCTTATAGCCCAACTGCTGG + Intergenic
1044654793 8:94536187-94536209 CAGTCTTTGAACCCTTCTTCTGG - Intronic
1050780696 9:9331072-9331094 CTGTATTTCAGCCCAACTGCAGG - Intronic
1051228604 9:14929647-14929669 CACTATTTCAGCCCCACTCCTGG + Intergenic
1055353839 9:75417429-75417451 CAGTCCTCCAGTCCTAGTGCTGG - Intergenic
1055353852 9:75417554-75417576 CAGTCATCCAGTCCTAGTGCAGG - Intergenic
1055353912 9:75417967-75417989 CAGTCCTCCAGTCCTAGTGCCGG - Intergenic
1055353919 9:75418009-75418031 CAGTCCTCCAGTCCTAGTGCCGG - Intergenic
1055353926 9:75418051-75418073 CAGTCCTCCAGTCCTAGTGCCGG - Intergenic
1055353933 9:75418093-75418115 CAGTCCTCCAGTCCTAGTGCCGG - Intergenic
1055353958 9:75418219-75418241 CAGTCCTCCAGTCCTAGTGCCGG - Intergenic
1055353965 9:75418261-75418283 CAGTCCTCCAGTCCTAGTGCCGG - Intergenic
1055353972 9:75418303-75418325 CAGTCCTCCAGTCCTAGTGCCGG - Intergenic
1055353979 9:75418345-75418367 CAGTCCTCCAGTCCTAGTGCCGG - Intergenic
1056968845 9:91186282-91186304 CAGTCTTGCAACCCTGCTCCCGG + Intergenic
1057951442 9:99372011-99372033 AAGTTTTTCAGCCCAACTGGTGG - Intergenic
1062099230 9:134719561-134719583 CTGTTTTCCAGCCCTCCTGCAGG - Intronic
1189050966 X:37645142-37645164 CATTCTTACAGCCTGACTGCTGG - Intronic
1189095841 X:38138412-38138434 CAATCTTTCAGGCCTACTAGTGG + Intronic
1190897576 X:54636158-54636180 CAGTCTTTTAGCCCCAAGGCAGG + Intergenic
1191667343 X:63716895-63716917 CTGTTTTTCAGGGCTACTGCTGG + Intronic
1194130859 X:90080057-90080079 CACACTTTCAGCCCTTCTGGAGG + Intergenic
1195853812 X:109309634-109309656 CAGTCTATCACCCCCACTGTCGG + Intergenic
1197167294 X:123392092-123392114 CTGTGCTGCAGCCCTACTGCTGG + Intronic
1198390844 X:136172279-136172301 CATTCATTCAGCCCTACTATGGG + Intronic
1199744520 X:150763473-150763495 CAGTCTTCCAGCCCCGCTGAGGG + Intronic