ID: 998341411

View in Genome Browser
Species Human (GRCh38)
Location 5:141421289-141421311
Sequence TGGGGACGCTGCGGGGGTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998341402_998341411 12 Left 998341402 5:141421254-141421276 CCGCAGTCGGCTGCTGCTGCTGC 0: 1
1: 0
2: 7
3: 107
4: 610
Right 998341411 5:141421289-141421311 TGGGGACGCTGCGGGGGTTCCGG 0: 1
1: 0
2: 0
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998341411 Original CRISPR TGGGGACGCTGCGGGGGTTC CGG Exonic
900149300 1:1171213-1171235 AGGGGAGGCTGCAGGGGTTGGGG + Intergenic
900189368 1:1346771-1346793 TGGGGACGCTGAGGAGGCCCTGG - Intronic
900494217 1:2969160-2969182 TGGGGAGGCTGCTGCGGTCCTGG + Intergenic
902213453 1:14920356-14920378 TGGGGAGGCTGCTCTGGTTCTGG - Intronic
903174921 1:21575050-21575072 GGCGGAGGCTGCGAGGGTTCAGG + Intronic
903291227 1:22315472-22315494 AGGGGAGGCTGCGGGGGTGTGGG + Intergenic
903373650 1:22852585-22852607 TGGGGGCAATGCGGGGGTCCAGG + Intronic
903833888 1:26190428-26190450 TGGGGATGCTGTGGGGATGCTGG - Intergenic
911585175 1:99682021-99682043 GGAGGAGGTTGCGGGGGTTCTGG + Intronic
920404639 1:205700131-205700153 TGAGGCCGGTGCGGTGGTTCAGG + Intergenic
923526837 1:234779086-234779108 TGGGGCCGGTGGGGGGGTGCGGG + Intergenic
1069904659 10:71725245-71725267 TGAGGAGGCTGCGGGTCTTCTGG - Intronic
1072722607 10:97790012-97790034 TGGGGGTGCTGCTGGGGTACAGG + Intergenic
1072920117 10:99569746-99569768 TGTGGAGGCTGCTGGGGTTGTGG + Intergenic
1073293387 10:102424322-102424344 TCGGGCCGCTGCAGGGGCTCTGG + Exonic
1076475429 10:130748533-130748555 GGGGGAGGCTGCCGGGGTTCGGG - Intergenic
1076793650 10:132788810-132788832 TGCAGACGCCGCGGGGGTGCCGG - Intergenic
1077352034 11:2097522-2097544 GGGGGAGGCTGGGAGGGTTCAGG + Intergenic
1078603297 11:12752387-12752409 TGGGGAGGCTTAGGAGGTTCTGG - Intronic
1080384499 11:31803200-31803222 TGGGGACACTGCTGGGGTTATGG - Intronic
1081999427 11:47385491-47385513 TGGGGATTCTTCTGGGGTTCTGG - Intergenic
1082162531 11:48900704-48900726 TGGCGACGCGGCGGGGGGTGGGG - Intergenic
1082657749 11:55873123-55873145 TGGCGACGCGGCGGGGGGTGGGG - Intergenic
1083815182 11:65128591-65128613 TGGGGAGGCTCCTGGGGTTGGGG + Exonic
1083998738 11:66284713-66284735 TGGAGACGCTGCCGGGGGACGGG + Exonic
1084302800 11:68262240-68262262 TGGGGACGCATAGGGGGTACAGG + Exonic
1084359920 11:68662510-68662532 TGGGGAGGCTGTGGGGGAGCAGG + Intergenic
1084643946 11:70443441-70443463 AGCGGAAGCTGCGGGCGTTCTGG + Intergenic
1084942072 11:72618271-72618293 TGGGGAGGCTGGAGGGGTGCAGG - Intronic
1085697350 11:78716293-78716315 TGGGGAAGAAGAGGGGGTTCAGG - Intronic
1086455323 11:86954972-86954994 TGGGGCCGGCGCGGGGCTTCGGG - Exonic
1090482518 11:127080833-127080855 GGGGGAGGCTGCTGGGATTCTGG - Intergenic
1091220705 11:133928487-133928509 TGGGGCAGCTCAGGGGGTTCAGG - Intronic
1093925270 12:24902988-24903010 TGGGGAGGCTGCGGGGACGCGGG + Exonic
1098041181 12:66355541-66355563 TGGGGCCGGTGTGGGGGTGCTGG - Intronic
1101835549 12:108292500-108292522 GGCGAACGCTGCGGTGGTTCTGG + Exonic
1104848230 12:131857863-131857885 TGGGTACTCTGGGGCGGTTCTGG + Intergenic
1104968538 12:132520780-132520802 TGGGGACACTGTGAGGGCTCTGG + Intronic
1105284210 13:18991608-18991630 TGGGGAGGCTGCAGGAGTTTTGG - Intergenic
1107458093 13:40573502-40573524 TGGGGACCCTCAGGTGGTTCAGG - Intronic
1112580540 13:100674066-100674088 TGCGAACTCTGCGGGGCTTCTGG - Intronic
1113709266 13:112453144-112453166 TCAGGACGCTGCTGGGGGTCAGG - Intergenic
1119732814 14:76961857-76961879 TGGGGCCGCAGCGGGGCTTCCGG - Intergenic
1120987017 14:90343631-90343653 TGGGGACGCTGTGGGGGTAGTGG + Intergenic
1121085753 14:91144930-91144952 TGGGGAGCCTGCGGGGCCTCAGG + Intronic
1122415867 14:101549214-101549236 CGGGGACGCTGTGGGGGTCTGGG - Intergenic
1122785257 14:104160521-104160543 TGGGGAAGCTGCAGGGATTGAGG + Intronic
1122937587 14:104967191-104967213 TGGGGAGGCTGCGGAGGGACGGG - Intronic
1123031012 14:105451082-105451104 TGGACACGCTGGGGGTGTTCAGG - Intronic
1123053429 14:105558812-105558834 TGGGGTCCCTGCTGGGGTTGAGG + Intergenic
1123078006 14:105679226-105679248 TGGGGTCCCTGCTGGGGTTGAGG + Intergenic
1123107351 14:105848706-105848728 TGAGGAGGCTGTGGGGGCTCTGG + Intergenic
1123119393 14:105909770-105909792 TGGGGACACTGTGGGGCTCCAGG + Intergenic
1125519746 15:40341078-40341100 TGGGGACGCTGGGGTGGGGCAGG - Intergenic
1128987451 15:72231446-72231468 TGGGGACGCGGCGGGGCAACGGG + Intronic
1130017823 15:80201307-80201329 TGGGGAGGGGGCTGGGGTTCAGG + Intergenic
1132025968 15:98404577-98404599 TGGGGAAGCTGGGTAGGTTCCGG + Intergenic
1132915528 16:2341489-2341511 AGGGGAGGGTGGGGGGGTTCGGG + Intergenic
1133310595 16:4843852-4843874 TTGGGAGGCTGAGGGGGTTGGGG + Intronic
1133995455 16:10744556-10744578 TGGGGACACAGCTGGGGATCAGG + Intronic
1136666696 16:31819275-31819297 TGAGGACGCCGCTGGGGGTCAGG - Intergenic
1137285282 16:47010587-47010609 GGGGGAGGCTGCAGGAGTTCAGG + Intergenic
1137567613 16:49543330-49543352 TGGGGAGGCTGTGGGGATTGGGG - Intronic
1138497056 16:57415312-57415334 TGGGGAGCCTGCAGGGGTTGGGG - Intronic
1139527937 16:67528223-67528245 TGGGGACGCTGGCAGGGTCCGGG - Intronic
1141603889 16:85142267-85142289 TGTGGAGGCTGCGGGGTCTCTGG + Intergenic
1142130133 16:88428502-88428524 TGAGGTCGCTGTGGCGGTTCAGG - Exonic
1142419275 16:89960605-89960627 TGGGGAAGCTGAGGGGCTTGGGG + Intronic
1142496453 17:308869-308891 TTGGGAAGCTGTGGGGGTCCTGG - Intronic
1142509656 17:385829-385851 CGGGGACGCGGCGGGGGGTGGGG - Intronic
1142638061 17:1270197-1270219 TGGGGCCGCTGTGGGGTGTCTGG - Intergenic
1142764784 17:2058927-2058949 TGGCGACGCTGCGGTTGTCCCGG - Exonic
1143490245 17:7281824-7281846 TGCGGAGGCCGCGGGGGTCCCGG - Exonic
1144741910 17:17588546-17588568 TGGGGACAGTGAGGGGGTTATGG - Intronic
1145010469 17:19364964-19364986 TTGGGACCCTGCAGGGGCTCTGG - Intronic
1145826077 17:27878136-27878158 TGGGCAAGCTGAGGGGTTTCAGG - Intronic
1147238088 17:39072282-39072304 TGGGGAGGCAGGGGGGCTTCTGG - Intronic
1150479605 17:65499248-65499270 GAGGGACGCTGAGGGGGTGCTGG - Intergenic
1150733801 17:67718222-67718244 TGGGGACGCTGAGTGAGGTCTGG + Intronic
1151727835 17:75894830-75894852 TGGCCAGGCTGCGGGGGGTCCGG + Intronic
1151822500 17:76504287-76504309 TGGGGAGGCAGCGGGGGCTCAGG + Intergenic
1152015339 17:77746971-77746993 TGGGGAGGCGGAGGGGGCTCTGG - Intergenic
1152390371 17:80000733-80000755 TGGGGGCATTGTGGGGGTTCAGG - Intronic
1152589278 17:81203460-81203482 TGGGGAGGCCGCGGGGCTGCGGG - Intronic
1155166423 18:23235990-23236012 TGGAGAGGCTGCGGTGGCTCAGG - Exonic
1158635259 18:59150574-59150596 TGGGGACGCCCCTGGGGTTGGGG + Intronic
1160390180 18:78524025-78524047 CGAGGACGCCGCGGGTGTTCTGG - Intergenic
1160412936 18:78687470-78687492 TGGGGGAGCAGAGGGGGTTCCGG - Intergenic
1160575206 18:79849192-79849214 TGGGGAGGCTGTGGAGGTTGAGG - Intergenic
1160686401 19:438896-438918 TGGGGACGCTGCGGCCATCCTGG - Intronic
1160696735 19:488716-488738 TGGGCTCGCTGCGGGGGTCGGGG - Intergenic
1160717576 19:583367-583389 TGGGGAGGCTTCTGCGGTTCTGG - Exonic
1161040786 19:2109822-2109844 AGGGGAGGCGGAGGGGGTTCGGG + Intronic
1161299926 19:3537642-3537664 AGGGGAGGCTGTGGGGGTCCTGG + Intronic
1161396452 19:4047332-4047354 TGGGGGCGCTGGGGGGGGACTGG - Exonic
1162079542 19:8209834-8209856 TGGGGACGCAGCTGGGGCCCTGG + Intronic
1164996085 19:32720816-32720838 TGGGGGCGCAGGGAGGGTTCAGG - Intronic
1165154434 19:33778448-33778470 TAGGGGCGCTGCGGGTGTTTGGG - Intergenic
1165331313 19:35142529-35142551 TGGGGAGACTGCGGGTATTCTGG + Intronic
1165832180 19:38735686-38735708 TGGGGGCGGGGCGGGGGTTCTGG + Intronic
1165832191 19:38735706-38735728 TGGGGGCGGGGCGGGGGTTCTGG + Intronic
1165832202 19:38735726-38735748 TGGGGGCGGGGCGGGGGTTCTGG + Intronic
1165832213 19:38735746-38735768 TGGGGGCGGGGCGGGGGTTCTGG + Intronic
1165832252 19:38735816-38735838 TGGGGGCGGGGCGGGGGTTCTGG + Intronic
1167464707 19:49644714-49644736 TGGGGAAGCTGCGGGAATTGAGG + Intronic
1167473753 19:49688884-49688906 TGGGGACACTGAGTGGGTTGGGG + Exonic
1167831786 19:52028828-52028850 TGGGGATAGGGCGGGGGTTCTGG + Intronic
925409675 2:3632793-3632815 TGGGGACTCAGTGGGGGTCCCGG - Intronic
927557625 2:24047255-24047277 TGGGGAGGCTGTAGGGGGTCAGG - Intronic
928088437 2:28359863-28359885 AGGGGAGGCTGCTGGGGCTCCGG + Intergenic
928322570 2:30295279-30295301 TGGGGACCCTGCTGGGGTCTGGG - Intronic
928997027 2:37303475-37303497 TGGGGCCTCTGGGGGGTTTCAGG + Intronic
930087570 2:47508692-47508714 AGGGAACGCAGCGGGGGCTCAGG + Intronic
936530106 2:113270339-113270361 TGGGGATGCTGCAGGGCTTCTGG - Intronic
937163760 2:119793126-119793148 TGGGGACGCTGCAGGAGACCAGG + Intronic
941903003 2:170695476-170695498 TGGGGACCCTGCTTGGGGTCAGG + Intergenic
944252445 2:197591617-197591639 TGGGGAGGCTCCGGTGGTGCAGG + Intronic
946339955 2:219060532-219060554 CGGGAGCGCTGCGGGGGCTCAGG + Intergenic
1171196307 20:23202135-23202157 TGGGGAAGCTGCGGGACTTGGGG - Intergenic
1171878493 20:30599250-30599272 TGGGGCTGCTGCTGGGATTCAGG + Intergenic
1172470374 20:35189341-35189363 TGGGGACGCTGCAGGAGACCAGG - Intergenic
1175966560 20:62662757-62662779 TGGGCACCCTGGGGGGGTCCTGG - Intronic
1175966576 20:62662803-62662825 TGGGCACCCTGGGGGGGTTCTGG - Intronic
1176096151 20:63345446-63345468 TGGGGACACTGGGGGGCTGCCGG + Exonic
1176246575 20:64100091-64100113 TGAGGACACTGCGGGGGTTGGGG + Exonic
1179433722 21:41345147-41345169 TGGGCAGGCTGAGGGGGCTCTGG + Intronic
1179481626 21:41682143-41682165 TGGGGGCCCTGCAGGGGTCCAGG - Intergenic
1179724244 21:43333015-43333037 GGGGCACGCTGCGGGGGGTGGGG + Intergenic
1180952313 22:19726081-19726103 TGAGGACGCTGCGGACGTTGAGG + Intergenic
1181478780 22:23184550-23184572 TGGGGAGGCTGTGGGGGTGTAGG - Intronic
1183273636 22:36877664-36877686 CCGGGACGCTGAGGGGGATCTGG + Exonic
1184131079 22:42516743-42516765 GGTGGAGGCAGCGGGGGTTCTGG + Intronic
1184616002 22:45639249-45639271 TGGGGTCGCTGTGGAGGTTAGGG + Intergenic
1185339037 22:50283504-50283526 TGGGGAGGCTGAGGGGGTGAGGG - Intronic
1185388707 22:50547928-50547950 TGGGGATGCGGCTGGGGTTAGGG - Intergenic
950871541 3:16233939-16233961 TGAGGAGGCAGCTGGGGTTCTGG + Intergenic
951522401 3:23621773-23621795 TGGGGACGCTGTGAGGGAACAGG + Intergenic
953980536 3:47410913-47410935 TGGGGAGGCTGAGGGGGCCCAGG - Exonic
961200224 3:125039475-125039497 TTGGCCCGCTGCGGGGGTTGAGG - Intronic
961735744 3:129001387-129001409 TGGTGGCGCTGCCGGGGTCCCGG + Intronic
963969726 3:151416330-151416352 TGGGGAGGCTGCTGGGGCTGGGG - Exonic
964476283 3:157100483-157100505 TGGGGGTGCAGCGGGGGTTGGGG + Intergenic
965385067 3:168036139-168036161 TGGGGATTTTGCGGGGGTTAGGG - Intronic
967567422 3:190988622-190988644 TGGGGACTCTGTGGGGGTGGGGG - Intergenic
968085161 3:195870901-195870923 TGGGCCCGCTGTGTGGGTTCTGG + Intronic
968405802 4:338196-338218 TGGGGAAGGTGCGGGGCTGCGGG - Intronic
968522903 4:1042254-1042276 TGGGGAGGCTGAGGGAGTTGAGG - Intergenic
969240610 4:5894568-5894590 TGGTCACGCTGCGGGAGCTCTGG - Intergenic
972621325 4:40750337-40750359 TGGGGACGCGGACGGGGCTCCGG + Intronic
977089533 4:92652727-92652749 TTGGGAGGCTGGGGGGGTTGGGG + Intronic
982730790 4:158953531-158953553 TAGGGACTCTGTGGGGGCTCTGG - Intronic
983638879 4:169925730-169925752 TGGGGTCACTGAGGGGCTTCCGG + Intergenic
984944706 4:184961889-184961911 TGTGGCCGCTGCAGAGGTTCTGG + Intergenic
985129686 4:186726833-186726855 CGTGGAGGCTGCGGGGGTCCCGG + Intergenic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
996019700 5:118577756-118577778 TGGGGAGGCTGCTGGGGCCCAGG - Intergenic
997319110 5:132963391-132963413 CCGGGAGGCGGCGGGGGTTCCGG + Exonic
997680323 5:135745744-135745766 TGGGGACACAGCTGGGGATCAGG - Intergenic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998341411 5:141421289-141421311 TGGGGACGCTGCGGGGGTTCCGG + Exonic
1000226105 5:159263396-159263418 TGGAGACGCTGTTGGGGCTCGGG + Intronic
1001604148 5:172948126-172948148 TGGGGGCGCTGGGGGGATTATGG - Intronic
1002286453 5:178165712-178165734 TGCGGGCGCTGCCGGGGCTCAGG + Intergenic
1004005817 6:11636467-11636489 TGGGGACGGTGTGAGGGATCAGG + Intergenic
1006643089 6:35498302-35498324 TGGGGGCGCTGAGGGGCTGCTGG + Exonic
1006839712 6:37020743-37020765 TGGGAACGCTCCGAGGCTTCTGG + Intronic
1007633882 6:43286717-43286739 TGGGGACTCTTCCTGGGTTCTGG + Exonic
1007897473 6:45377731-45377753 GGGGGGCGGTGCGGGGATTCGGG - Intronic
1009857847 6:69287568-69287590 TGGGGACATTGCAGTGGTTCTGG - Intronic
1017826703 6:158086959-158086981 GGGGGTCTCTGCGGGGGTTGAGG - Exonic
1019095746 6:169577637-169577659 TGGGGAGGCTGCGGGGCTCACGG - Intronic
1019475105 7:1240651-1240673 TGGGGACGGGGCGGGGGCTGTGG + Intergenic
1025144510 7:56492567-56492589 TTGGGGCCCTGAGGGGGTTCGGG + Intergenic
1026038126 7:66844531-66844553 GGGGGACGCTGCGGGGTCCCCGG + Intergenic
1032462722 7:132123892-132123914 TGGGGATGATGCAGGGGTTTTGG - Exonic
1035743888 8:1947737-1947759 TGGGGACAGTGCGGGGGGCCGGG - Intronic
1036258595 8:7223318-7223340 TGGGGAAGCTCAGGGAGTTCAGG - Intergenic
1036308024 8:7616190-7616212 TGGGGAAGCTCAGGGAGTTCAGG + Intergenic
1036310650 8:7681914-7681936 TGGGGAAGCTCAGGGAGTTCAGG - Intergenic
1036358880 8:8064191-8064213 TGGGGAAGCTCAGGGAGTTCAGG + Intergenic
1036892078 8:12602761-12602783 TGGGGAAGCTCAGGGAGTTCAGG - Intergenic
1036899623 8:12660736-12660758 TGGGGAAGCTCAGGGAGTTCAGG - Intergenic
1040284343 8:46092311-46092333 AGGGGGCGCTCTGGGGGTTCTGG - Intergenic
1040300232 8:46184174-46184196 TGGGCAGGCTGCAGGGATTCAGG - Intergenic
1040614819 8:49024595-49024617 TGGTGAAGCTGCTGGGCTTCTGG + Intergenic
1041001377 8:53457740-53457762 TGGGGACTCTCGGGGGGTTGGGG + Intergenic
1044086280 8:87945775-87945797 TGGGGACGCTGCAGGAGACCAGG + Intergenic
1044464012 8:92482824-92482846 TGGGGACACTGAGGGGGAGCAGG + Intergenic
1045649124 8:104326540-104326562 TGTGGACTCTGCAGGGGTCCAGG + Intergenic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049571697 8:143372849-143372871 GGGGGACAATGCGGGGGTTTGGG + Intronic
1049571728 8:143372927-143372949 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049571743 8:143372965-143372987 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049571773 8:143373041-143373063 AGGGGACGGTGCGGGGGTTTGGG + Intronic
1049571788 8:143373079-143373101 AGGGGACGGTGCGGGGGCTTGGG + Intronic
1049571804 8:143373118-143373140 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049571850 8:143373234-143373256 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049571880 8:143373310-143373332 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049571913 8:143373387-143373409 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049571928 8:143373425-143373447 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049571943 8:143373463-143373485 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049571993 8:143373579-143373601 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1049572025 8:143373656-143373678 AGGGGACGGTGTGGGGGTTTGGG + Intronic
1054806533 9:69401203-69401225 TGTGGACGCTGATGAGGTTCAGG + Intergenic
1057259860 9:93577247-93577269 GGGGGAGGCGGCGGGGGCTCCGG - Intronic
1057317588 9:93979652-93979674 TGTGGAGGCTGCAGGAGTTCAGG - Intergenic
1059451328 9:114372953-114372975 TGGGGACGCAGCGGGGGGGGGGG + Intronic
1059497275 9:114720187-114720209 TGGTGAGGCTGCCAGGGTTCGGG + Intergenic
1060549526 9:124478373-124478395 TGGGGCCGCTGTTGGGGCTCAGG - Exonic
1060931285 9:127491091-127491113 TGGGGAGGCTGGGGAGGCTCTGG - Intronic
1061782365 9:133003669-133003691 AGGAGACGCTGTGGGGGGTCTGG + Intergenic
1062176767 9:135167682-135167704 AGGGGAAGAGGCGGGGGTTCAGG + Intergenic
1062289774 9:135789300-135789322 GGGTGACGGTGCCGGGGTTCTGG + Intronic
1062412825 9:136433492-136433514 TGGGGTCTCGGCGGGGGTCCAGG - Intronic
1062617676 9:137405310-137405332 TGGGGAAGCAGCGGGGGTTGGGG - Intronic
1187607817 X:20905627-20905649 TGGGGAGCCTGCAGGGGTTGGGG + Intergenic
1190660775 X:52652581-52652603 TAGGGACGGTGTGGGGGTGCCGG + Intronic
1192212562 X:69137155-69137177 GGGGGACGGGGCGGGGCTTCTGG - Intergenic
1198177877 X:134173360-134173382 TGGGGAGCGTGCGGGGGTTGGGG + Intergenic
1200079112 X:153566793-153566815 AGGGGACGCAGCGGGAGTTGGGG - Intronic